Apsectrotanypus trifascipennis

(Zetterstedt, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Chironomidae/Apsectrotanypus

At a glance

Occurrence records2 693

Data sources6

Biological traits0

DNA specimens32

eDNA detections78

Sources6 archives

Databases and archives Apsectrotanypus trifascipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 693 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 693 records

Environmental DNA3 datasets · 7 countries78 detections

DNA & barcodingBOLD32 specimens

01Narrative

Apsectrotanypus trifascipennis is een muggensoort uit de familie van de dansmuggen (Chironomidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1838 door Zetterstedt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apsectrotanypus trifascipennis has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes4

eDNA detections78

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

217Avariable

271Cmostly conserved

364Cvariable

373Amostly conserved

433Gvariable

466Avariable

565Gmostly conserved

616Cvariable

628Avariable

AACTTTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTAGGTACCTCCCTTAGTATCTTAATTCGAGCCGAGCTAGGCCATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes10

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Limnophyes spinigussame family12.2%Conchapelopia pallenssame family12.3%Tanypus neopunctipennissame family12.6%Derotanypus alaskensissame family12.7%Trichina pallipessame order13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P28SCAD4

animal barcodemarker

08Occurrence & distribution

Record type2 693 records

Wild obs. + sensor2 299

Museum / vouchered394

Range

Area of Occupancy AOO3 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 2 047≤1 km 20≤10 km 58

2 125 georeferenced · 174 without coordinates

Open the mapobservation + sensor2 299

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 215≤10 km 10

225 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence394

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	7
NCMGlocation not on record	4
CBDClocation not on record	3
Rovaniemi, FI	2
SLU Artdatabankenlocation not on record	1

5 institutions · 17 of 394 vouchered records shown · 377 without an institution code

09Environmental DNA78 detections

Where the DNA of Apsectrotanypus trifascipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys3

Countries7

Verifiable raw sequence linked55

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map7 countries0

2nd order headwater stream draining in agric…Forest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 9.00–16.2

Seasonal swing summer↔winter21.5 °C

Max temp (day)16.7 °C 12.2–19.6

Min temp (night)9.40 °C 5.40–12.4

Precipitation88.0 mm/mo 53.7–119

Air humidity61.1 % 57.8–64.0

Moisture balance18.3 mm/mo -46.9–50.1

Vapour deficit602 Pa 409–754

Wind speed2.50 m/s 1.90–3.80

Cloud cover51.7 % 44.6–58.6

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apsectrotanypus trifascipennis

At a glance

Sources6 archives

At a glance

Record type2 693 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 693 records