Aprostocetus caudatus

Westwood, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eulophidae/Aprostocetus

At a glance

Occurrence records237

Data sources6

Biological traits0

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Aprostocetus caudatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF237 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Aprostocetus caudatus is een vliesvleugelig insect uit de familie Eulophidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1833 door Westwood.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aprostocetus caudatus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

3Avariable

15Avariable

18Avariable

135Avariable

189Gvariable

195Tvariable

231Cvariable

234Avariable

273Avariable

276Tvariable

279Cvariable

303Tvariable

306Avariable

372Tvariable

375Avariable

381Avariable

516Tvariable

519Tvariable

573Cvariable

GGAATATCTATAAGAATAATTATTCGAATAGAATTAGGAAATCCTGGTTCAATAATTGGTAATGATCAAATTTATAATGCTATTGTTACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BIN1

Most divergent pair3.0%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Baryscapus coerulescenssame family5.6%Oomyzus tanacetisame family6.2%Oomyzus galerucivorussame family7.0%Baryscapus fumipennissame family7.2%Quadrastichus malhamensissame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type237 records

Wild obs. + sensor2

Museum / vouchered235

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 57≤1 km 178

235 georeferenced

Open the institutions mapphysical evidence235

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MZLUlocation not on record	217
SLU Artdatabankenlocation not on record	18

2 institutions · 235 of 235 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aprostocetus caudatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)