Aprognathodon platyventris

Böhlke, 1967 · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Ophichthidae/Aprognathodon

At a glance

Occurrence records105

Data sources9

Biological traits6

DNA specimens8

eDNA detections8

Sources9 archives

Databases and archives Aprognathodon platyventris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

OBISOcean Biodiversity Information System59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS105 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

The stripe eel, Aprognathodon platyventris, is a species of eel in the family Ophichthidae. It is the only member of its genus. It is found in the western Atlantic Ocean from the Florida Keys through the Caribbean islands to Venezuela in reef environments.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length46 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max17 m

Depth min0 m

Vulnerability36

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aprognathodon platyventris has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

223Tmostly conserved

325Amostly conserved

346Gmostly conserved

364Tmostly conserved

628Amostly conserved

CCTGTACTTAGTATTTGGTGCTTGGGCTGGAATAGTGGGTACTGCTCTAAGCCTACTAATTCGAGCTGAACTAAGTCAACCTGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes4

BIN1

Most divergent pair0.61%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ophichthus puncticepssame family13.0%Ophichthus remigersame family13.3%Callechelys muraenasame family14.1%Callechelys catostomasame family14.3%Ophichthus rufussame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type105 records

Wild obs. + sensor15

Museum / vouchered90

Range

Area of Occupancy AOO176 km²

Depth

0–200 m sunlit18

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9.4 m · max 28 m · 18 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 10>10 km 1

11 georeferenced · 4 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤1 km 6≤10 km 17>10 km 5

28 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Washington, US	4
Chicago, US	4
Cambridge, US	3
North Carolina Museum of Natural Scienceslocation not on record	3
Tapachula, MX	2
New Haven, US	2
FishBaselocation not on record	1
CASlocation not on record	1
Toronto, CA	1
University of California San Diegolocation not on record	1
Ann Arbor, US	1
Frankfurt am Main	1

13 institutions · 40 of 90 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Aprognathodon platyventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.8–27.5

Seasonal swing summer↔winter2.90 °C

Max temp (day)25.9 °C 25.7–28.2

Min temp (night)24.4 °C 24.0–26.5

Precipitation171 mm/mo 44.2–176

Air humidity61.8 % 60.7–63.0

Moisture balance12.7 mm/mo

Vapour deficit1,229 Pa 1,189–1,328

Wind speed4.80 m/s

Cloud cover26.9 % 24.5–28.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)