Aproaerema larseniella

(Gozmány, 1957) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Aproaerema

At a glance

Occurrence records237

Data sources8

Biological traits2

DNA specimens53

eDNA detections31

Sources8 archives

Databases and archives Aproaerema larseniella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF237 records

Environmental DNA1 datasets · 4 countries31 detections

DNA & barcodingBOLD53 specimens

01Narrative

Syncopacma larseniella is a moth of the family Gelechiidae. It is found in most of Europe. The wingspan is about 12 mm. Adults are on wing in June and July. The larvae feed on Lotus corniculatus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aproaerema larseniella has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

eDNA detections31

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

360Gmostly conserved

398Tmostly conserved

629Gvariable

CATTATATTTTATTTTCGGAATTTGAGCAGGAATAATTGGTACCTCTCTTAGATTATTAATTCGAGCAGAATTAGGTAACCCTGGACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes7

BIN1

Most divergent pair4.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aproaerema patruellasame genus5.0%Aproaerema taeniolellasame genus5.2%Aproaerema wormiellasame genus5.3%Aproaerema coronillellasame genus6.7%Aproaerema cincticulellasame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type237 records

Wild obs. + sensor194

Museum / vouchered43

Origin

Native1

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 80≤1 km 73≤10 km 38

191 georeferenced · 3 without coordinates

Open the mapobservation + sensor194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 11≤1 km 10≤10 km 9

30 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	29
Natural History Museum, Londonlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
South Kensington, GB	1

4 institutions · 32 of 43 vouchered records shown · 11 without an institution code

09Environmental DNA31 detections

Where the DNA of Aproaerema larseniella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map4 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 10.2–19.6

Seasonal swing summer↔winter12.8 °C

Max temp (day)21.1 °C 13.3–23.7

Min temp (night)12.6 °C 6.70–16.8

Precipitation71.3 mm/mo 48.7–166

Air humidity60.9 % 57.7–63.7

Moisture balance-27.7 mm/mo -80.1–52.7

Vapour deficit776 Pa 479–938

Wind speed2.70 m/s 2.10–4.70

Cloud cover40.2 % 32.3–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)