Aproaerema cinctella

(Clerck, 1759) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Aproaerema

At a glance

Occurrence records3 732

Data sources9

Biological traits2

DNA specimens75

eDNA detections95

Sources9 archives

Databases and archives Aproaerema cinctella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI95 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 732 records

Environmental DNA3 datasets · 11 countries95 detections

DNA & barcodingBOLD75 specimens

Genome at a glanceNCBI≈453 Mbp

01Narrative

Syncopacma cinctella is a moth of the family Gelechiidae. It is found in all of Europe, Asia Minor and North Africa.funet.fi In the east, the range extends through Siberia to the Russian Far East. The wingspan is 10–14 mm. The forewings are bronzy-black; a nearly straight narrow white fascia beyond middle. Hindwings are fuscous, darker posteriorly. Under-surface with white fascia appearing only as a costal spot on forewings. The larva is pale green, suffused with reddish head pale yellow-brown; 2 with four black semilunules filled with yellow-brown. Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing from June to August. The larvae feed on Lotus corniculatus. The larvae live between leaves spun together with silk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aproaerema cinctella has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes1

eDNA detections95

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

67Avariable

160Avariable

166Avariable

220Cmostly conserved

241Avariable

340Cvariable

346Tvariable

412Tvariable

463Tmostly conserved

556Avariable

578Cvariable

652Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACTTCTCTTAGCTTATTAATTCGAGCAGAATTAGGAAATCCCGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes16

BIN1

Most divergent pair1.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aproaerema cinctelloidessame genus5.5%Aproaerema sangiellasame genus7.0%Aproaerema cincticulellasame genus7.1%Aproaerema patruellasame genus7.9%Aproaerema metadesmasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Aproaerema cinctella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈453 122 976 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aproaerema cinctella0.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 732 records

Wild obs. + sensor3 302

Museum / vouchered426

Other4

Range

Area of Occupancy AOO5 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 545≤1 km 1 010≤10 km 699>10 km 6

3 260 georeferenced · 42 without coordinates

Open the mapobservation + sensor3 302

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 195≤1 km 129≤10 km 44

368 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence426

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	105
Kuopio, FI	86
SLU Artdatabankenlocation not on record	30
DanishLepidopterologicalSocietylocation not on record	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	16
NTNU-VMlocation not on record	10
Rovaniemi, FI	8
Salzburg, AT	6
neflocation not on record	5
Research Collection of Theo Gruenewaldlocation not on record	3
ZMAAlocation not on record	3
BioFokuslocation not on record	2
Tartu, EE	2
Helsinki, FI	2
Provincia di Livornolocation not on record	1
Trondheim, NO	1
Philadelphia, US	1
NTNU University Museum, Department of Natural Historylocation not on record	1

18 institutions · 300 of 426 vouchered records shown · 126 without an institution code

09Environmental DNA95 detections

Where the DNA of Aproaerema cinctella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found95

Studies independent surveys3

Countries11

Verifiable raw sequence linked21

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 95 detections have coordinates

Open the map11 countries0

Hay meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 5.30–17.5

Seasonal swing summer↔winter20.4 °C

Max temp (day)18.6 °C 8.60–21.8

Min temp (night)10.6 °C 1.30–13.7

Precipitation98.9 mm/mo 49.8–200

Air humidity59.0 % 55.7–63.7

Moisture balance-13.9 mm/mo -87.3–93.6

Vapour deficit688 Pa 375–905

Wind speed2.70 m/s 1.90–5.30

Cloud cover40.1 % 33.6–52.7

CHELSA 1981–2010, ~9 km grid, at location & month of 95 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aproaerema cinctella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 732 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 732 records