Apriona rugicollis

Chevrolat, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Apriona

At a glance

Occurrence records515

Data sources8

Biological traits0

DNA specimens17

eDNA detections2

Sources8 archives

Databases and archives Apriona rugicollis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility515 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF515 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT2n = 36

01Narrative

Apriona rugicollis is a species of beetle in the family Cerambycidae. It was described by Chevrolat in 1852. It is known from China, Cambodia, Japan, Taiwan, North Korea, South Korea, and Vietnam.BioLib.cz - Apriona rugicollis. Retrieved on 8 September 2014.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apriona rugicollis has left across the world's sequence archives.

At a glance

DNA specimens17

BINs4

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 82 variable positions, in barcode order

5Tmostly conserved

9Cvariable

26Amostly conserved

35Tvariable

41Amostly conserved

44Tmostly conserved

54Cvariable

59Tvariable

62Amostly conserved

80Tvariable

83Amostly conserved

95Amostly conserved

98Cvariable

101Cvariable

107Tmostly conserved

126Gmostly conserved

134Tmostly conserved

149Tmostly conserved

154Tmostly conserved

167Tvariable

197Tmostly conserved

200Cmostly conserved

206Avariable

207Cmostly conserved

212Tvariable

227Cvariable

230Cmostly conserved

236Amostly conserved

260Gmostly conserved

278Tvariable

290Amostly conserved

292Gmostly conserved

311Tvariable

314Amostly conserved

320Tmostly conserved

323Amostly conserved

332Tmostly conserved

335Cmostly conserved

347Tmostly conserved

359Cvariable

362Tmostly conserved

374Tvariable

395Tmostly conserved

401Tmostly conserved

402Tvariable

407Tmostly conserved

410Amostly conserved

413Tmostly conserved

416Tmostly conserved

419Amostly conserved

423Cmostly conserved

425Tmostly conserved

428Tmostly conserved

452Amostly conserved

485Tmostly conserved

494Cmostly conserved

495Tmostly conserved

497Amostly conserved

509Cvariable

518Amostly conserved

521Amostly conserved

524Tmostly conserved

527Tmostly conserved

530Tmostly conserved

537Cmostly conserved

539Tmostly conserved

542Cvariable

543Cmostly conserved

545Tvariable

557Amostly conserved

563Amostly conserved

576Tmostly conserved

578Amostly conserved

581Tmostly conserved

586Gmostly conserved

602Tmostly conserved

605Cmostly conserved

629Cvariable

632Tvariable

636Tmostly conserved

638Avariable

647Cvariable

TGTATTTTCTATTTGGAGCTTGAGCAAGAATAGTTGGAACAGCTTTAAGATTACTAATTCGAACAGAATTAGGTACCCCTGGATCATTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.1%

Haplotypes3

BINs4

Most divergent pair9.6%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Microgoes oculatussame family11.8%Plagiohammus spinipennissame family12.7%Plagiohammus emanonsame family13.2%Plagiohammus nitidussame family13.3%Plagiohammus thiodessame family13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Apriona rugicollis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type515 records

Wild obs. + sensor507

Museum / vouchered8

Range

Area of Occupancy AOO1 712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 219≤1 km 76≤10 km 24>10 km 50

369 georeferenced · 138 without coordinates

Open the mapobservation + sensor507

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
FACTlocation not on record	8

1 institutions · 8 of 8 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Apriona rugicollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)