Aprion virescens

Valenciennes, 1830 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Lutjanidae/Aprion

At a glance

Occurrence records17 318

Data sources8

Biological traits0

DNA specimens39

eDNA detections71

Sources8 archives

Databases and archives Aprion virescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 987 records↗

OBISOcean Biodiversity Information System9 331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

GoaTGenomes on a Tree · Sangergenome ~0.67 Gbp↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS17 318 records

Environmental DNA2 datasets · 11 countries71 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT665 Mbp

01Narrative

L'Aprion verdâtre est un poisson marin de la famille des Lutjanidae et du genre monotypique Aprion. Il est appelé aussi mékoua en Nouvelle-Calédonie et job à La Réunion.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aprion virescens has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes2

eDNA detections71

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

54Tmostly conserved

265Tmostly conserved

304Amostly conserved

355Tvariable

415Cmostly conserved

484Gmostly conserved

547Cmostly conserved

619Gvariable

625Gmostly conserved

646Avariable

652Tmostly conserved

CCTGTATTTAGTATTCGGTGCTTGAGCCGGAATAGTAGGCACTGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAACCAGGTGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes7

BIN1

Most divergent pair0.77%

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lutjanus lunulatussame family13.4%Kyphosus pacificussame order13.5%Lutjanus carponotatussame family13.7%Etelis oculatussame family13.7%Etelis coruscanssame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Aprion virescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size665 040 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aprion virescens0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type17 318 records

Wild obs. + sensor10 903

Museum / vouchered6 250

Cultivated / captive2

Other163

Origin

Native2

Range

Area of Occupancy AOO7 772 km²

Depth

0–200 m sunlit5 473

200–1000 m twilight9

1–4 km midnight0

>4 km abyssal0

median 14.9 m · max 650 m · 5 482 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 6 320≤1 km 2 371≤10 km 98>10 km 142

8 931 georeferenced · 1 972 without coordinates

Open the mapobservation + sensor10 903

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 11≤1 km 180≤10 km 1 190>10 km 4 540

5 921 georeferenced · 329 without coordinates

Open the institutions mapphysical evidence6 250

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OCEAClocation not on record	2 821
Sydney, AU	90
Kagoshima University Museumlocation not on record	30
CSIRO Oceans and Atmospherelocation not on record	24
Washington, US	23
South African Institute for Aquatic Biodiversitylocation not on record	17
Australian National Fish Collectionlocation not on record	10
Chicago, US	8
Paris, FR	8
Natick, US	6
CASlocation not on record	5
Toronto, CA	4
Museum and Art Gallery of the Northern Territorylocation not on record	4
Cambridge, US	3
Los Angeles, US	2
Fisheries Research Laboratory, Mie Universitylocation not on record	2
Wuzhou, CN	2
FishBaselocation not on record	2
Western Australian Museumlocation not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Frankfurt am Main	2
Australian Museum, Sydneylocation not on record	2
Copenhagen, DK	2
	1
Geneva, CH	1
ICM-CSIClocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Food Research Institute, Ministry of Agriculture, Forestry and Fisherieslocation not on record	1
Institut de Recherche pour le Developpement, Francelocation not on record	1
Muséum National d'Histoire Naturellelocation not on record	1

30 institutions · 3 078 of 6 250 vouchered records shown · 13 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA71 detections

Where the DNA of Aprion virescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys2

Countries11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map11 countries0

Marineocean surface water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.9 °C 22.9–27.9

Seasonal swing summer↔winter2.60 °C

Max temp (day)28.6 °C 25.4–28.6

Min temp (night)26.2 °C 20.4–27.0

Precipitation303 mm/mo 42.0–329

Air humidity63.4 % 60.7–67.6

Vapour deficit1,365 Pa 957–1,370

Cloud cover64.8 % 22.0–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aprion virescens

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type17 318 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 318 records