Appias sylvia

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Appias

At a glance

Occurrence records451

Data sources6

Biological traits0

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Appias sylvia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility451 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF451 records

DNA & barcodingBOLD6 specimens

01Narrative

Appias sylvia, the woodland albatross white or common albatross, is a butterfly in the family Pieridae. It is found in Senegal, Gambia, Guinea, Sierra Leone, Liberia, Ivory Coast, Ghana, Togo, Benin, Nigeria, Equatorial Guinea (Bioko), Cameroon, the Republic of the Congo, the Central African Republic, the Democratic Republic of the Congo, Sudan, Ethiopia, Angola, Namibia, Zambia, Kenya, Uganda, Tanzania and Malawi. The habitat consists of forests. Males come to damp patches and both sexes are attracted to flowers. The larvae feed on Drypetes (including Drypetes ugandensis and Drypetes gerrardii), Phyllanthus and Ritchiea species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appias sylvia has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hamearis lucinasame order8.2%Archon apollinussame order8.2%Crocidolomia pavonanasame order8.5%Udea murinalissame order8.5%Graphium angolanussame order8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type451 records

Wild obs. + sensor48

Museum / vouchered403

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 16≤1 km 4≤10 km 3>10 km 1

24 georeferenced · 24 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 8>10 km 7

16 georeferenced · 387 without coordinates

Open the institutions mapphysical evidence403

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MRAClocation not on record	257
Uniwersytet Jagiellońskilocation not on record	66
African Butterfly Research Institutelocation not on record	51
Cleveland Museum of Natural History, OH (CLEV)location not on record	10
Cambridge, US	8
Zürich, CH	6
Banyoles, ES	1
Auckland, NZ	1

8 institutions · 400 of 403 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)