Appias lyncida

(Cramer, 1779) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Appias

At a glance

Occurrence records3 116

Data sources8

Biological traits0

DNA specimens35

eDNA detections45

Sources8 archives

Databases and archives Appias lyncida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 116 records

Environmental DNA1 datasets · 7 countries45 detections

DNA & barcodingBOLD35 specimens

Genome at a glanceGoaT2n = 64

01Narrative

Appias lyncida, the chocolate albatross, is a butterfly of the family Pieridae, that is, the yellows and whites, which is found in south and southeast Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appias lyncida has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections45

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

31Tmostly conserved

43Amostly conserved

235Cvariable

271Cvariable

337Tmostly conserved

AACTTTATATTTTATTTTTGGAATCTGATCTGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes8

BIN1

Most divergent pair0.61%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Appias adasame genus4.6%Dixeia doxosame family6.8%Dixeia charinasame family7.2%Phoebis argantesame family7.8%Talima sullasame order8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_053273 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Appias lyncida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 641×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 116 records

Wild obs. + sensor1 960

Museum / vouchered1 141

Other15

Range

Area of Occupancy AOO5 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 472≤1 km 655≤10 km 294>10 km 162

1 583 georeferenced · 377 without coordinates

Open the mapobservation + sensor1 960

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 35≤10 km 234>10 km 420

689 georeferenced · 452 without coordinates

Open the institutions mapphysical evidence1 141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogorienselocation not on record	386
Cambridge, US	85
Natural History Museum, Tribhuvan Universitylocation not on record	36
Auckland, NZ	25
New Haven, US	20
Helsinki, FI	15
Cleveland Museum of Natural History, OH (CLEV)location not on record	13
Natural History Museum Rotterdamlocation not on record	12
Tomioka, JP	9
Yokosuka City Museumlocation not on record	8
Zürich, CH	7
University of Malaya, Museum of Zoologylocation not on record	6
Durban Natural Science Museumlocation not on record	3
Brussels, BE	3
RBINS-Scientific Heritagelocation not on record	3
Natural History Museum of Utahlocation not on record	2
Smithsonian Tropical Research Institute, Center for Tropical Forest Science, Khao Chong, Arthropod Laboratorylocation not on record	2
Toronto, CA	2
MZLUlocation not on record	2

19 institutions · 639 of 1 141 vouchered records shown · 502 without an institution code

09Environmental DNA45 detections

Where the DNA of Appias lyncida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map7 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 25.0–27.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)28.4 °C 26.9–30.7

Min temp (night)24.2 °C 20.6–26.0

Precipitation234 mm/mo 28.1–279

Air humidity65.9 % 61.8–69.5

Moisture balance77.5 mm/mo -119–131

Vapour deficit1,167 Pa 971–1,341

Wind speed1.90 m/s 1.20–5.20

Cloud cover49.2 % 16.3–70.7

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Appias lyncida

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 116 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 116 records