Appias indra

(Moore, 1858) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Appias

At a glance

Occurrence records719

Data sources7

Biological traits0

DNA specimens12

eDNA detections13

Sources7 archives

Databases and archives Appias indra's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility719 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF719 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD12 specimens

01Narrative

Appias indra, the plain puffin, is a small butterfly of the family Pieridae, that is, the yellows and whites, which is found in south and southeast Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appias indra has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P608 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

69Tmostly conserved

84Cvariable

132Amostly conserved

183Amostly conserved

309Cmostly conserved

399Gmostly conserved

453Tmostly conserved

537Tmostly conserved

582Cmostly conserved

ATAGTAGGTACATCTCTAAGTTTAATAATTCGAACTGAATTAGGAAACCCAGGTTCATTAATTGGAGATGATCAAATTTATAACACTATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes7

BIN1

Most divergent pair1.2%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Appias pandionesame genus5.6%Appias celestinasame genus9.0%Appias athamasame genus9.0%Ethmia melanocratessame order9.4%Pygospila tyressame order9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type719 records

Wild obs. + sensor276

Museum / vouchered442

Other1

Range

Area of Occupancy AOO1 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 52≤1 km 107≤10 km 51>10 km 25

235 georeferenced · 41 without coordinates

Open the mapobservation + sensor276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 13≤10 km 113>10 km 191

317 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence442

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogorienselocation not on record	102
Cambridge, US	29
Yokosuka City Museumlocation not on record	9
ZRClocation not on record	8
Zürich, CH	7
New Haven, US	5
Tomioka, JP	3
Auckland, NZ	3
Vietnam National Museum of Naturelocation not on record	2
Helsinki, FI	2
Natural History Museum Rotterdamlocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Natural History Museum, Tribhuvan Universitylocation not on record	1
University of Malaya, Museum of Zoologylocation not on record	1

14 institutions · 176 of 442 vouchered records shown · 266 without an institution code

09Environmental DNA13 detections

Where the DNA of Appias indra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.3 °C 25.4–27.1

Seasonal swing summer↔winter7.10 °C

Max temp (day)30.0 °C 29.2–30.8

Min temp (night)22.4 °C 21.6–23.2

Precipitation217 mm/mo 196–238

Air humidity68.7 % 68.4–69.1

Moisture balance70.6 mm/mo 54.9–86.3

Vapour deficit1,068 Pa 1,002–1,134

Wind speed1.90 m/s 1.80–1.90

Cloud cover65.2 % 64.1–66.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)