Appendiseta robiniae

(Gillette, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Appendiseta

At a glance

Occurrence records115

Data sources6

Biological traits0

DNA specimens52

eDNA detections54

Sources6 archives

Databases and archives Appendiseta robiniae's data was compiled from.

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF115 records

Environmental DNA2 datasets · 8 countries54 detections

DNA & barcodingBOLD52 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appendiseta robiniae has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections54

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

259Gvariable

439Cvariable

463Gvariable

496Cvariable

532Gvariable

625Amostly conserved

TTTATACTTTTTATTTGGAATTTGAGCAGGTATAATTGGATCATCATTAAGAATTTTAATTCGATTAGAACTTAGACAAATTAATTCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes3

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tinocallis zelkowaesame family10.9%Monelliopsis pecanissame family10.9%Tinocallis ulmiparvifoliaesame family10.9%Tinocallis saltanssame family11.2%Sarucallis kahawaluokalanisame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor60

Museum / vouchered55

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 22≤1 km 4≤10 km 3>10 km 1

30 georeferenced · 30 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 5≤10 km 30>10 km 1

36 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Essig Museum of Entomologylocation not on record	36
WIlocation not on record	8
Canadian Forest Service, Pacific Forestry Centrelocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

4 institutions · 52 of 55 vouchered records shown · 3 without an institution code

09Environmental DNA54 detections

Where the DNA of Appendiseta robiniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys2

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map8 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…1. Forest & Woodland | 1.4. Temperate ForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 13.0–24.6

Seasonal swing summer↔winter20.4 °C

Max temp (day)22.2 °C 19.1–32.7

Min temp (night)11.1 °C 5.90–18.0

Precipitation20.7 mm/mo 14.0–126

Air humidity49.3 % 43.2–60.3

Moisture balance-119 mm/mo -159–68.2

Vapour deficit915 Pa 673–1,536

Wind speed2.60 m/s 1.40–5.10

Cloud cover23.9 % 11.7–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)