Apotomops wellingtoniana

(Kearfott, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomops

At a glance

Occurrence records45

Data sources8

Biological traits0

DNA specimens12

eDNA detections10

Sources8 archives

Databases and archives Apotomops wellingtoniana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD12 specimens

01Narrative

Apotomops wellingtoniana is a species of moth of the family Tortricidae first described by William D. Kearfott in 1907.tortricidae.com It is found in North America from British Columbia to Nova Scotia, south through the Rocky Mountains to the Mexican states of Durango, Nuevo Leon, Distrito Federal and Veracruz. In the east, it ranges south to the Great Smoky Mountains in Tennessee., 2003, Zootaxa 303: 1-31 [1] The habitat consists of coniferous forests. The wingspan is about 20 mm.mothphotographersgroup The forewings are white with gray shading on the basal half and with a dark gray band. The hindwings are light grayish brown. The larvae feed on Abies, Tsuga and Picea species. They are solitary defoliators.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomops wellingtoniana has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

49Tvariable

59Tvariable

250Tvariable

265Gvariable

268Avariable

286Tvariable

287Tvariable

376Avariable

394Tvariable

401Tvariable

460Cvariable

463Tvariable

472Tvariable

499Tvariable

500Cvariable

542Cvariable

622Tmostly conserved

625Tmostly conserved

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BINs2

Most divergent pair2.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphelia albocilianasame family7.6%Aphelia stigmatanasame family7.8%Udea fulvalissame order8.4%Isotenes miseranasame family8.7%Argyrotaenia coconinanasame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor10

Museum / vouchered35

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 9≤10 km 1

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	14
University of Alberta Museums (UAM)location not on record	13
Denver, US	5
San Francisco, US	2
Mississippi State, US	1

5 institutions · 35 of 35 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Apotomops wellingtoniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 12.2–17.3

Seasonal swing summer↔winter19.7 °C

Max temp (day)20.0 °C 17.5–23.0

Min temp (night)9.50 °C 6.80–11.9

Precipitation118 mm/mo 102–165

Air humidity56.8 % 54.1–61.3

Moisture balance-21.3 mm/mo -28.0–51.0

Vapour deficit732 Pa 566–894

Wind speed2.30 m/s 1.60–3.10

Cloud cover39.7 % 27.1–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)