Apotoforma rotundipennis

(Walsingham, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotoforma

At a glance

Occurrence records17

Data sources8

Biological traits0

DNA specimens5

eDNA detections3

Sources8 archives

Databases and archives Apotoforma rotundipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD5 specimens

01Narrative

Apotoforma rotundipennis is a species of moth of the family Tortricidae. It is found on the Virgin Islands. The wingspan is about 11 mm. The forewings are tawny reddish, with a faintly indicated oblique greyish-fuscous shade from before the middle of the costa, extending to the lower edge of the cell. There is a similar curved shade before the apex and waved lines of sublustrous scales on the outer half of the wing and there is a small black dot at the end of the cell. The hindwings are greyish fuscous.Proceedings of the general meetings for scientific business of the Zoological Society of London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotoforma rotundipennis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 69% of positions are identical in every specimen.

Diversity (π)0.29%

Haplotypes0

BINs0

Where individuals differ — all 202 variable positions, in barcode order

202Tvariable

313Cvariable

326Nhighly variable

327Nhighly variable

328Nhighly variable

329Nhighly variable

330Nhighly variable

331Nhighly variable

332Nhighly variable

333Nhighly variable

334Nhighly variable

335Nhighly variable

336Nhighly variable

337Nhighly variable

338Nhighly variable

339Nhighly variable

340Nhighly variable

341Nhighly variable

342Nhighly variable

343Nhighly variable

344Nhighly variable

345Nhighly variable

346Nhighly variable

347Nhighly variable

348Nhighly variable

349Nhighly variable

350Nhighly variable

351Nhighly variable

352Nhighly variable

353Nhighly variable

354Nhighly variable

355Nhighly variable

356Nhighly variable

357Nhighly variable

358Nhighly variable

359Nhighly variable

360Nhighly variable

361Nhighly variable

362Nhighly variable

363Nhighly variable

364Nhighly variable

365Nhighly variable

366Nhighly variable

367Nhighly variable

368Nhighly variable

369Nhighly variable

370Nhighly variable

371Nhighly variable

372Nhighly variable

373Nhighly variable

374Nhighly variable

375Nhighly variable

376Nhighly variable

377Nhighly variable

378Nhighly variable

379Nhighly variable

380Nhighly variable

381Nhighly variable

382Nhighly variable

383Nhighly variable

384Nhighly variable

385Nhighly variable

386Nhighly variable

387Nhighly variable

388Nhighly variable

389Nhighly variable

390Nhighly variable

391Nhighly variable

392Nhighly variable

393Nhighly variable

394Nhighly variable

395Nhighly variable

396Nhighly variable

397Nhighly variable

398Nhighly variable

399Nhighly variable

400Nhighly variable

401Nhighly variable

402Nhighly variable

403Nhighly variable

404Nhighly variable

405Nhighly variable

406Nhighly variable

407Nhighly variable

408Nhighly variable

409Nhighly variable

410Nhighly variable

411Nhighly variable

412Nhighly variable

413Nhighly variable

414Nhighly variable

415Nhighly variable

416Nhighly variable

417Nhighly variable

418Nhighly variable

419Nhighly variable

420Nhighly variable

421Nhighly variable

422Nhighly variable

423Nhighly variable

424Nhighly variable

425Nhighly variable

426Nhighly variable

427Nhighly variable

428Nhighly variable

429Nhighly variable

430Nhighly variable

431Nhighly variable

432Nhighly variable

433Nhighly variable

434Nhighly variable

435Nhighly variable

436Nhighly variable

437Nhighly variable

438Nhighly variable

439Nhighly variable

440Nhighly variable

441Nhighly variable

442Nhighly variable

443Nhighly variable

+82 more variable positions not shown

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Synchlora aeratasame order5.8%Dysstroma brunneatasame order5.8%Crypsiphona ocultariasame order6.2%Negera quadricornissame order6.4%Nemoria elfasame order6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type17 records

Wild obs. + sensor3

Museum / vouchered14

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
Smithsonian Institution, National Museum of Natural Historylocation not on record	2

2 institutions · 14 of 14 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Apotoforma rotundipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 17.2–17.2

Seasonal swing summer↔winter14.4 °C

Max temp (day)23.1 °C

Min temp (night)13.5 °C

Precipitation56.6 mm/mo

Air humidity59.0 %

Moisture balance-13.3 mm/mo

Vapour deficit798 Pa

Wind speed2.40 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)