Apostenus fuscus

Westring, 1851 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Liocranidae/Apostenus

At a glance

Occurrence records1 725

Data sources8

Biological traits11

DNA specimens12

eDNA detections12

Sources8 archives

Databases and archives Apostenus fuscus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 725 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University11 traits · 23 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements23 literature sources11 traits

Occurrence & distributionGBIF1 725 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Apostenus fuscus est une espèce d'araignées aranéomorphes de la famille des Liocranidae.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 23 sources

Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Staręga et al. 2001SLU 2020Gajdoš et al. 2014Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Harvey et al. 2017Henriksen & Hilmo 2015Maelfait et al. 1998Řezáč et al. 2015Blick & Scheidler 2004Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick et al. 2016Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀3.45·♂3 mm

Predation2

Hunting guildground hunters

Simple hunting guild classificationcursorial

Ecology8

Ballooninglow

Light0.375 mm

Light 2partly shaded

Moisture 10.5 mm

Moisture 2very dry

Regional IUCN Red List categoryLeast Concern (lc)

Regional non-IUCN Red List categoryEndangered (EN)

Stratumsurface

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apostenus fuscus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

1Gmostly conserved

7Gmostly conserved

13Amostly conserved

14Tmostly conserved

22Amostly conserved

28Amostly conserved

31Tmostly conserved

67Tmostly conserved

82Amostly conserved

121Amostly conserved

130Tmostly conserved

133Tmostly conserved

148Gmostly conserved

163Amostly conserved

184Amostly conserved

200Gmostly conserved

232Amostly conserved

280Gmostly conserved

307Tmostly conserved

316Amostly conserved

328Amostly conserved

334Tmostly conserved

337Amostly conserved

359Gmostly conserved

364Amostly conserved

424Amostly conserved

430Gmostly conserved

431Gmostly conserved

478Amostly conserved

481Gmostly conserved

484Tmostly conserved

500Tvariable

508Gmostly conserved

535Gmostly conserved

562Amostly conserved

625Tmostly conserved

628Tmostly conserved

637Tmostly conserved

GACATTGTATTTATTATTTGGAGCTTGATCTGCAATAGTTGGTACTGCTATAAGAGTATTAATTCGTATAGAATTAGGACAATCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes5

BINs2

Most divergent pair5.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Clubiona lawrenceisame order9.9%Wulfila pulverulentussame order10.8%Anyphaena californicasame order10.8%Clubiona interjectasame order10.9%Clubiona bevisisame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 725 records

Wild obs. + sensor761

Museum / vouchered946

Cultivated / captive2

Other16

Origin

Native312

Range

Area of Occupancy AOO1 816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 111≤1 km 43≤10 km 446>10 km 5

605 georeferenced · 156 without coordinates

Open the mapobservation + sensor761

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 35≤1 km 11≤10 km 553>10 km 2

601 georeferenced · 345 without coordinates

Open the institutions mapphysical evidence946

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paro, BT	370
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	282
Brussels, BE	132
Provincia di Livornolocation not on record	31
Bonn, DE	17
Musee d'Histoire Naturallelocation not on record	13
Frankfurt am Main	9
SLU Artdatabankenlocation not on record	9
SNSB-Zoologische Staatssammlung Münchenlocation not on record	6
Bern, CH	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
LEBAlocation not on record	4
Akademia Pomorska w Słupskulocation not on record	3
Helsinki, FI	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	3
MZLUlocation not on record	3
Geneva, CH	2
ZSMlocation not on record	2
BioFokuslocation not on record	2
Uniwersytet w Białymstokulocation not on record	1

20 institutions · 902 of 946 vouchered records shown · 44 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Apostenus fuscus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Buchenwald, LaunstreuStreuobstwieseMischwald, in Laubstreu

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.30 °C 8.60–9.60

Seasonal swing summer↔winter16.2 °C

Max temp (day)12.3 °C 11.7–12.9

Min temp (night)5.90 °C 4.90–6.80

Precipitation60.8 mm/mo 53.5–100

Air humidity64.0 % 62.6–64.9

Moisture balance1.70 mm/mo

Vapour deficit463 Pa 458–485

Wind speed4.10 m/s

Cloud cover42.0 % 41.1–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apostenus fuscus

At a glance

Sources8 archives

Morphometry1

Predation2

Ecology8

At a glance

Record type1 725 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 725 records