Apostasia wallichii

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Apostasia

At a glance

Occurrence records321

Data sources8

Biological traits16

DNA specimens18

eDNA detections15

Sources8 archives

Databases and archives Apostasia wallichii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility321 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.11 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF321 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceGoaT1.1 Gbp

01Narrative

Apostasia nipponica ist eine Art aus der Gattung Apostasia und gehört somit zur Familie der Orchideen (Orchidaceae). Die kleinen krautigen Pflanzen besiedeln ein disjunktes Areal auf den Ryūkyū-Inseln und in Vietnam.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology3

Leaf length150 mm

Leaf width8.5 mm

Plant height max0.25 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formperennial or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apostasia wallichii has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes4

GenBank sequences10

eDNA detections15

Countries4

The DNA barcodea real sequence read deposited for this species

ITSAB451545.1 ↗808 bpMalaysia

ACGT

CGCTGTGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAGGGATCATTGT …

Apostasia wallichii genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL4★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Apostasia wallichii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 110 030 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apostasia wallichii1.11 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type321 records

Wild obs. + sensor43

Museum / vouchered274

Cultivated / captive4

Origin

Native5

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤1 km 2≤10 km 1>10 km 40

43 georeferenced

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 2≤1 km 6≤10 km 126>10 km 1

135 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence274

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 3

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	42
Smithfield, AU	41
Canberra, AU	40
Saint Louis, US	8
South Kensington, GB	8
Mount Annan, AU	5
Museo Entomologico de Leonlocation not on record	5
Copenhagen, DK	4
Honolulu, US	4
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Cambridge, US	3
Bronx, US	3
Moscow State Universitylocation not on record	2
Clocation not on record	2
Xiamen, CN	2
Claremont, US	2
Edinburgh, GB	2
James Cook Townsvillelocation not on record	1
Paris, FR	1
Australian Tropical Herbariumlocation not on record	1
Taipei, TW	1
Adelaide, AU	1
Harvard Universitylocation not on record	1

23 institutions · 182 of 274 vouchered records shown · 89 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Apostasia wallichii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.5–24.7

Seasonal swing summer↔winter12.1 °C

Max temp (day)28.5 °C 24.2–29.8

Min temp (night)17.7 °C 15.0–21.5

Precipitation51.5 mm/mo 15.6–243

Air humidity53.1 % 43.4–67.0

Moisture balance-74.7 mm/mo -143–111

Vapour deficit1,333 Pa 973–1,624

Wind speed3.40 m/s 1.30–4.00

Cloud cover26.8 % 18.1–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)