Aporosa villosa

(Lindl.) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Aporosa

At a glance

Occurrence records297

Data sources7

Biological traits29

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Aporosa villosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility297 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF297 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Aporosa villosa is a species of shrub or small tree in the family Phyllanthaceae. It is found in Southeast Asia, including the Nicobar, Andaman and Paracel Islands. There are some traditional medicinal uses for plant, particularly around care after childbirth. The shrub is often a pioneer species, tolerant of full sun, but intolerant of frequent fires.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Leaf length105 mm

Leaf length max130 mm

Leaf length min80 mm

Leaf width62.5 mm

Leaf width max80 mm

Leaf width min45 mm

Plant height5.25 m

Plant height max7 m

Plant height min2 m

Life cycle & reproduction5

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Elevation max1 500 m

Elevation mean815 m

Elevation min130 m

Epiphyteterrestrial

Growth formtree

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporosa villosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR531764.1 ↗479 bp

ACGT

AACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGA …

Aporosa villosa isolate BB0193 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type297 records

Wild obs. + sensor70

Museum / vouchered227

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 70 records without

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 227 records without

Open the institutions mapphysical evidence227

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	97
Guangzhou, CN	14
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	13
Beijing, CN	11
Chengdu, CN	6
Yangling, CN	5
Guangzhou, CN	3
Kew, GB	3
Edinburgh, GB	3
Paris, FR	2
Stockholm, SE	2
Saint Louis, US	2
Bronx, US	1
Guilin, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	1
Monastir, TN	1

17 institutions · 166 of 227 vouchered records shown · 61 without an institution code

09Environmental DNA1 detections

Where the DNA of Aporosa villosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)21.6 °C

Min temp (night)12.2 °C

Precipitation178 mm/mo

Air humidity65.7 %

Moisture balance78.2 mm/mo

Vapour deficit677 Pa

Wind speed1.80 m/s

Cloud cover43.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)