Aporosa octandra

(Buch.-Ham. ex D.Don) Vickery · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Aporosa

At a glance

Occurrence records199

Data sources9

Biological traits46

DNA specimens21

eDNA detections13

Sources9 archives

Databases and archives Aporosa octandra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources46 traits

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB2n = 52

01Narrative

Aporosa octandra là một loài thực vật có hoa trong họ Diệp hạ châu. Loài này được Vickery mô tả khoa học đầu tiên năm 1982.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length11.5 mm

Fruit length max13 mm

Fruit length min10 mm

Leaf length90 mm

Leaf length max120 mm

Leaf length min60 mm

Leaf size2 062 mm²

Leaf width47.5 mm

Leaf width max60 mm

Leaf width min35 mm

Plant height9 m

Seed mass39 mg

Seed mass max39 mg

Seed mass min39 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation mean1 000 m

Elevation min300 m

Epiphyteterrestrial

Growth formtree

Leaf formelliptic

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry10

Leaf C:N ratio26.97 g/g

Leaf c448 mg/g

Leaf dry-matter content (LDMC)287 mg/g

Leaf n17.55 mg/g

Leaf p0.905 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.93 mm²/mg

Wood density645 mg/cm³

Wood density max670 mg/cm³

Wood density min620 mg/cm³

Other traits5

Leaf marginfinely toothed

Leaf spinesno

Leaf thornsno

Sla max14.93 mm²/mg

Sla min14.93 mm²/mg

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporosa octandra has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes3

GenBank sequences4

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMG838499.1 ↗504 bpIndonesia

ACGT

TATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGAAGCG …

Aporosa octandra voucher KR0038 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aporosa octandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 263×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · book-ipcn67-71 — MEHRA, P.N., & A.S. HANS. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type199 records

Wild obs. + sensor150

Museum / vouchered49

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 91≤1 km 26≤10 km 8>10 km 8

133 georeferenced · 17 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cibinong Science Center, Herbarium Bogorienselocation not on record	12
Edinburgh, GB	6
Kew, GB	6
Moscow State Universitylocation not on record	3
Bronx, US	2
University of Stellenboschlocation not on record	1
Wlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1
South Kensington, GB	1
Fort Worth, US	1
Stockholm, SE	1
Beijing, CN	1
Kagoshima, JP	1
BMlocation not on record	1
Berlin, DE	1

16 institutions · 40 of 49 vouchered records shown · 9 without an institution code

09Environmental DNA13 detections

Where the DNA of Aporosa octandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Forested mountain slopesHills

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 22.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 25.4–29.5

Min temp (night)22.6 °C 18.4–22.6

Precipitation269 mm/mo 150–269

Air humidity68.1 % 63.0–68.1

Moisture balance133 mm/mo 41.2–133

Vapour deficit1,080 Pa 913–1,080

Wind speed1.20 m/s 1.20–3.90

Cloud cover57.6 % 54.6–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)