Aporocera iridipennis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aporocera

At a glance

Occurrence records389

Data sources5

Biological traits0

DNA specimens5

eDNA detections5

Sources5 archives

Databases and archives Aporocera iridipennis's data was compiled from.

GBIFGlobal Biodiversity Information Facility389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF389 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporocera iridipennis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

22Cmostly conserved

59Tmostly conserved

64Cmostly conserved

88Gmostly conserved

133Avariable

166Gmostly conserved

202Amostly conserved

235Cmostly conserved

247Tmostly conserved

316Gmostly conserved

317Gmostly conserved

319Tmostly conserved

352Amostly conserved

355Cmostly conserved

469Amostly conserved

478Amostly conserved

508Amostly conserved

511Amostly conserved

538Tmostly conserved

556Cmostly conserved

562Tmostly conserved

565Amostly conserved

634Cmostly conserved

AACCCTATACTTCCTTTTTGGCGCCTGATCAGGAATAGTTGGTACTTCATTAAGTTTATTAATCCGAATTGAACTTGGGAACCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BINs2

Most divergent pair3.0%

Oceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type389 records

Wild obs. + sensor315

Museum / vouchered74

Range

Area of Occupancy AOO1 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 126≤1 km 49≤10 km 16>10 km 32

223 georeferenced · 92 without coordinates

Open the mapobservation + sensor315

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	31
Museums Victorialocation not on record	23
Natick, US	19
Sydney, AU	1

4 institutions · 74 of 74 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Aporocera iridipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–26.6

Seasonal swing summer↔winter8.60 °C

Max temp (day)29.0 °C 28.3–29.7

Min temp (night)19.0 °C 19.0–23.8

Precipitation34.2 mm/mo 34.2–190

Air humidity61.3 % 60.0–61.3

Moisture balance-124 mm/mo -124–16.2

Vapour deficit1,125 Pa 1,125–1,375

Wind speed1.80 m/s 1.80–2.90

Cloud cover24.9 % 24.9–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)