Aporia genestieri

Oberthür, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Aporia

At a glance

Occurrence records14

Data sources6

Biological traits0

DNA specimens16

eDNA detections1

Sources6 archives

Databases and archives Aporia genestieri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aporia genestieri is een vlindersoort uit de familie van de Pieridae (witjes), onderfamilie Pierinae. Aporia genestieri werd in 1902 beschreven door Oberthür.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporia genestieri has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes2

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 115 variable positions, in barcode order

2Amostly conserved

7Amostly conserved

14Amostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

28Gmostly conserved

31Tmostly conserved

46Amostly conserved

49Tmostly conserved

59Amostly conserved

62Amostly conserved

65Cmostly conserved

67Amostly conserved

69Cmostly conserved

70Tmostly conserved

74Cmostly conserved

81Amostly conserved

84Cmostly conserved

85Tmostly conserved

87Gmostly conserved

88Amostly conserved

97Cmostly conserved

101Gmostly conserved

106Tvariable

107Cmostly conserved

110Amostly conserved

112Cmostly conserved

115Cmostly conserved

120Cmostly conserved

124Tmostly conserved

126Tmostly conserved

127Amostly conserved

128Amostly conserved

129Cmostly conserved

132Cmostly conserved

138Cmostly conserved

163Tmostly conserved

178Tmostly conserved

181Gvariable

184Gmostly conserved

189Gmostly conserved

190Tmostly conserved

194Tmostly conserved

198Tmostly conserved

199Amostly conserved

200Gmostly conserved

202Cmostly conserved

203Cmostly conserved

205Cmostly conserved

206Cmostly conserved

217Amostly conserved

226Tmostly conserved

235Cmostly conserved

238Cmostly conserved

241Amostly conserved

264Tmostly conserved

266Cmostly conserved

268Gmostly conserved

271Tmostly conserved

277Cvariable

283Cmostly conserved

286Gmostly conserved

289Amostly conserved

294Cmostly conserved

295Cmostly conserved

299Gmostly conserved

300Cmostly conserved

307Tmostly conserved

337Tmostly conserved

346Amostly conserved

364Amostly conserved

368Amostly conserved

370Amostly conserved

389Amostly conserved

400Cmostly conserved

403Amostly conserved

407Cmostly conserved

428Cmostly conserved

436Amostly conserved

447Tmostly conserved

451Tmostly conserved

475Cmostly conserved

498Cmostly conserved

499Amostly conserved

500Cmostly conserved

517Cmostly conserved

520Tmostly conserved

521Amostly conserved

539Cmostly conserved

541Amostly conserved

542Amostly conserved

550Avariable

553Tmostly conserved

559Tmostly conserved

562Amostly conserved

565Tmostly conserved

568Tmostly conserved

586Amostly conserved

587Gmostly conserved

588Amostly conserved

604Cmostly conserved

609Tmostly conserved

612Tmostly conserved

622Gmostly conserved

631Gmostly conserved

634Cmostly conserved

637Amostly conserved

640Tmostly conserved

642Tmostly conserved

648Amostly conserved

650Cmostly conserved

652Tmostly conserved

653Tmostly conserved

654Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGGTCTGGAATAGTAGGTACATCTTTAAGATTAATAATTCGAACTGAACTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes6

BINs2

Most divergent pair2.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aporia martinetisame genus7.6%Mesapia peloriasame family9.0%Aporia bietisame genus9.1%Aporia crataegisame genus9.3%Aporia potaninisame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor11

Museum / vouchered3

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 1≤10 km 2>10 km 2

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1>10 km 2

3 georeferenced

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	3

1 institutions · 3 of 3 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aporia genestieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)