Aporandria specularia

(Guenée, 1857) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aporandria

At a glance

Occurrence records205

Data sources7

Biological traits0

DNA specimens11

eDNA detections10

Sources7 archives

Databases and archives Aporandria specularia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF205 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Aporandria is a monotypic moth genus in the family Geometridae described by Warren in 1894. Its single species, Aporandria specularia, was first described by Achille Guenée in 1857. It is found in Sri Lanka, India, Vietnam, Thailand, the Andamans, Peninsular Malaysia, Sumatra, Borneo, the Philippines and Sulawesi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporandria specularia has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections10

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

10Cmostly conserved

43Amostly conserved

49Tmostly conserved

79Amostly conserved

82Tmostly conserved

115Tmostly conserved

133Amostly conserved

166Amostly conserved

181Gmostly conserved

199Gmostly conserved

202Amostly conserved

214Amostly conserved

220Cmostly conserved

235Tmostly conserved

263Tmostly conserved

271Cmostly conserved

284Cmostly conserved

286Tmostly conserved

295Amostly conserved

304Cmostly conserved

316Gmostly conserved

337Cmostly conserved

340Tmostly conserved

343Amostly conserved

352Amostly conserved

403Amostly conserved

412Amostly conserved

433Gmostly conserved

451Tmostly conserved

508Cmostly conserved

514Cmostly conserved

520Amostly conserved

541Amostly conserved

542Tvariable

548Cmostly conserved

553Tvariable

556Tmostly conserved

565Amostly conserved

574Cmostly conserved

581Tmostly conserved

616Cmostly conserved

631Amostly conserved

634Tmostly conserved

637Tmostly conserved

646Tmostly conserved

AACATTATACTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes5

BINs3

Most divergent pair5.0%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chorodnodes rothisame family7.1%Maxates orthodesmasame family7.1%Coelocrossa hypocroceasame family7.4%Leuciris fimbriariasame family7.6%Heterolocha biplagiatasame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type205 records

Wild obs. + sensor204

Museum / vouchered1

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 67≤1 km 62≤10 km 19>10 km 12

160 georeferenced · 44 without coordinates

Open the mapobservation + sensor204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Aporandria specularia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 17.3–26.7

Seasonal swing summer↔winter4.10 °C

Max temp (day)26.5 °C 22.5–29.5

Min temp (night)20.2 °C 11.6–22.9

Precipitation204 mm/mo 113–446

Air humidity68.3 % 57.1–74.7

Moisture balance75.1 mm/mo -10.9–316

Vapour deficit949 Pa 662–1,150

Wind speed1.30 m/s 1.20–2.80

Cloud cover45.5 % 23.9–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)