Apophysomyces elegans

P.C.Misra, K.J.Srivast. & Lata · species

image placeholder — illustration coming later

Fungi/Mucoromycota/Mucoromycetes/Mucorales/Saksenaeaceae/Apophysomyces

At a glance

Occurrence records544

Data sources6

Biological traits0

DNA specimens8

eDNA detections539

Sources6 archives

Databases and archives Apophysomyces elegans's data was compiled from.

GBIFGlobal Biodiversity Information Facility544 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI539 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF544 records

Environmental DNA3 datasets · 4 countries539 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceNCBI≈38 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apophysomyces elegans has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections539

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP788908.1 ↗431 bpOman

ACGT

AAAACTAGAACCATCTCTTATCCTGTGCAATGAATTTGTCGCCTGGGGTTTGAAAATAGTCTTTTTTGGGCTCATCTTCTTGGGCCTTTT …

Apophysomyces elegans isolate 821 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Apophysomyces elegans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈38 467 560 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Apophysomyces elegans0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type544 records

Museum / vouchered544

Range

Area of Occupancy AOO1 240 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 543 without coordinates

Open the institutions mapphysical evidence544

10Collections & institutions

Institution	Specimens
UAclocation not on record	1

1 institutions · 1 of 544 vouchered records shown · 541 without an institution code

09Environmental DNA539 detections

Where the DNA of Apophysomyces elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found539

Studies independent surveys3

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 539 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 9.00–29.0

pH6.56 4.00–9.60

Conductivity125 µS/cm 6.00–188,388

Organic carbon1.51 % 0.004–16.3

Water content8.69 % 0.362–48.7

Nitrate-N4.00 mg/kg 0.5–284

Phosphorus13.0 mg/kg 2.00–290

Clay18.5 % 1.00–67.0

Sand63.9 % 12.1–97.1

Depth0 m 0–0.9

SoilMarineTenosolKurosolPodosolVertosolVertosolsCalcarosol

521 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.7–24.6

Seasonal swing summer↔winter11.9 °C

Max temp (day)22.4 °C 16.6–30.2

Min temp (night)13.0 °C 8.20–19.2

Precipitation46.9 mm/mo 9.40–79.2

Air humidity55.9 % 45.1–59.2

Moisture balance-83.8 mm/mo -141–-19.2

Vapour deficit827 Pa 622–1,616

Wind speed3.80 m/s 2.80–4.80

Cloud cover21.9 % 12.8–35.7

CHELSA 1981–2010, ~9 km grid, at location & month of 532 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)