Apopestes spectrum

(Esper, 1787) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Apopestes

At a glance

Occurrence records1 584

Data sources7

Biological traits0

DNA specimens8

eDNA detections5

Sources7 archives

Databases and archives Apopestes spectrum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 584 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 584 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD8 specimens

01Narrative

Apopestes spectrum is a species of moth in the family Erebidae first described by Eugenius Johann Christoph Esper in 1787.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apopestes spectrum has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

22Tvariable

31Avariable

103Tvariable

202Amostly conserved

220Cmostly conserved

346Cmostly conserved

370Gvariable

428Tvariable

553Avariable

565Gvariable

601Cmostly conserved

616Cvariable

622Avariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.00%

Haplotypes3

BINs2

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Autophila asiaticasame family6.9%Lascoria anxasame family7.4%Lophotarsia ochroproctasame order7.4%Antiblemma subrutilanssame family7.6%Baritius maribellealvarezaesame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 584 records

Wild obs. + sensor1 157

Museum / vouchered208

Other219

Origin

Native65

Range

Area of Occupancy AOO3 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 418≤1 km 235≤10 km 157>10 km 67

877 georeferenced · 280 without coordinates

Open the mapobservation + sensor1 157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 3≤1 km 24≤10 km 136>10 km 9

172 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	51
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	17
Dhaka, BD	16
Provincia di Livornolocation not on record	14
UMUlocation not on record	14
Bern, CH	11
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	11
Paro, BT	9
Universität Zürich, Naturhistorisches Museumlocation not on record	8
Naturmuseum Oltenlocation not on record	7
Museum zu Allerheiligen Schaffhausenlocation not on record	6
Naturmuseum St. Gallenlocation not on record	4
Frauenfeld, CH	4
Glarus, CH	4
Uniwersytet Łódzkilocation not on record	4
Radicondoli, IT	3
Musee d'Histoire Naturallelocation not on record	2
ZSMlocation not on record	2
Toronto, CA	2
Winterthur, CH	2
Philadelphia, US	1
Nijmegen, NL	1

22 institutions · 193 of 208 vouchered records shown · 15 without an institution code

09Environmental DNA5 detections

Where the DNA of Apopestes spectrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Garriga

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 11.3–16.1

Seasonal swing summer↔winter17.1 °C

Max temp (day)19.8 °C 15.2–21.0

Min temp (night)9.00 °C 5.30–10.5

Precipitation43.7 mm/mo 27.2–80.5

Air humidity53.1 % 50.0–57.9

Moisture balance-66.6 mm/mo -128–-16.6

Vapour deficit787 Pa 592–906

Wind speed3.20 m/s 2.50–4.80

Cloud cover31.1 % 28.5–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apopestes spectrum

At a glance

Sources7 archives

At a glance

Record type1 584 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 584 records