Aponogeton ulvaceus

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Aponogetonaceae/Aponogeton

At a glance

Occurrence records78

Data sources9

Biological traits9

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Aponogeton ulvaceus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Aponogeton ulvaceus is a submerged aquatic plant in the Aponogetonaceae family. It has a small cone shaped, slightly hairy rhizome about in diameter. The leaf blades have a base that tapers gradually, pale green in colour (reddish under intense light), over long and broad, with a wavy margin on petioles of an equal length, and in appearance slightly translucent. A single bulb may produce up to forty leaves in good conditions. No floating leaves are formed. The yellow flowers are produced on one or two, and sometimes more, erect spikes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous hydrogeophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticaquatic

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Aquatic

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aponogeton ulvaceus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences8

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSHQ456450.1 ↗707 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGAGCGATCACACACCGCGAACGCTTGACCGAGATCTGTACCGAGCTCCG …

Aponogeton ulvaceus voucher Eggers s.n. (M) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aponogeton ulvaceus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Uchiyama, H. 1989. Karyomorphological studies on some taxa of the Helobiae. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 22: 271–352.

08Occurrence & distribution

Record type78 records

Museum / vouchered78

Range

Area of Occupancy AOO84 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence78

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Plocation not on record	21
Saint Louis, US	16
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	15
Kew, GB	13
Glocation not on record	4
Paris, FR	3
Stockholm, SE	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
CJBGlocation not on record	1
MeiseBGlocation not on record	1

10 institutions · 77 of 78 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Aponogeton ulvaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)