Aponogeton capuronii — The Life Data

Plantae/Tracheophyta/Liliopsida/Alismatales/Aponogetonaceae/Aponogeton

At a glance

Occurrence records5

Data sources9

Biological traits9

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Aponogeton capuronii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF5 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Aponogeton capuronii (named after René Paul Raymond Capuron) is an aquatic plant found in southeastern Madagascar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous hydrogeophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticaquatic

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Aquatic

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aponogeton capuronii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSHQ456427.1 ↗722 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCTTCTAGACCCAAGGAGCACACCGCGAACGAGTGACCCATCTGTCCCGGGCTCTCCGCGCCA …

Aponogeton capuronii voucher van Bruggen s.n. (CONN) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aponogeton capuronii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bruggen, H. W. E. v. 1985. Monograph of the genus Aponogeton (Aponogetonaceae). Biblioth. Bot. 137: 1–76.

08Occurrence & distribution

Record type5 records

Museum / vouchered5

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

10Collections & institutions

Institution	Specimens
Plocation not on record	4
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aponogeton capuronii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.