Aponia minnithalis

Druce, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Aponia

At a glance

Occurrence records94

Data sources6

Biological traits0

DNA specimens69

eDNA detections73

Sources6 archives

Databases and archives Aponia minnithalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI73 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 2 countries73 detections

DNA & barcodingBOLD69 specimens

01Narrative

Aponia minnithalis is a moth in the family Crambidae. It was described by Druce in 1895. It is found in Guatemala and Panama.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aponia minnithalis has left across the world's sequence archives.

At a glance

DNA specimens69

BINs1

Marker genes1

eDNA detections73

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

160Gmostly conserved

364Cmostly conserved

496Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes12

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aponia itzalissame genus6.2%Emphylica xanthocrossasame family7.4%Loxostege oberthuralissame family7.6%Loxostege egregialissame family7.6%Uresiphita polygonalissame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Museum / vouchered94

Range

Area of Occupancy AOO144 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 94 records without

Open the institutions mapphysical evidence94

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	75
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Tapachula, MX	2
Mississippi State, US	1

4 institutions · 81 of 94 vouchered records shown · 13 without an institution code

09Environmental DNA73 detections

Where the DNA of Aponia minnithalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found73

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 73 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.0–25.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.2 °C 25.6–28.5

Min temp (night)21.6 °C 20.7–21.8

Precipitation288 mm/mo 83.3–478

Air humidity69.3 % 65.5–75.0

Moisture balance151 mm/mo -44.1–344

Vapour deficit914 Pa 700–1,049

Wind speed2.30 m/s 1.00–3.80

Cloud cover34.2 % 16.0–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)