Apomyelois bistriatella

Hulst, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Apomyelois

At a glance

Occurrence records1 779

Data sources9

Biological traits0

DNA specimens50

eDNA detections49

Sources9 archives

Databases and archives Apomyelois bistriatella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 779 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 779 records

Environmental DNA1 datasets · 9 countries49 detections

DNA & barcodingBOLD50 specimens

Genome at a glanceGoaT · NCBI≈390 Mbp

01Narrative

Apomyelois bistriatella is a species of snout moth in the genus Apomyelois. It was described by George Duryea Hulst in 1887. It is known from California, the eastern United States, northern Europe and Russia.Fauna Europaea The wingspan is 15–25 mm.Microlepidoptera.nl Adults are on wing from June to July. The larvae feed on a fungus, Daldinia vernicosa, which grows on burnt gorse and dead birch. It has also been recorded feeding on Hypoxylon occidentale in California.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apomyelois bistriatella has left across the world's sequence archives.

At a glance

DNA specimens50

BINs2

Marker genes1

eDNA detections49

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

44Avariable

82Cvariable

121Cvariable

169Cvariable

220Tvariable

274Cvariable

287Tvariable

382Avariable

430Avariable

442Cvariable

448Cvariable

483Avariable

508Gvariable

529Tvariable

541Cmostly conserved

604Cvariable

613Cvariable

616Tmostly conserved

628Gmostly conserved

634Cvariable

640Tvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGATTAATTGGTACATCATTAAGATTATTAATTCGAACTGAATTAGGAACCCCTAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes14

BINs2

Most divergent pair3.3%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eurhodope monogrammossame family8.2%Ephestia fredisame family8.2%Melitara apicigrammellasame family9.1%Interjectio columbiellasame family9.1%Myelois fuscicostellasame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apomyelois bistriatella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈389 556 621 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apomyelois bistriatella0.39 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type1 779 records

Wild obs. + sensor1 384

Museum / vouchered392

Other3

Range

Area of Occupancy AOO3 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 742≤1 km 335≤10 km 248>10 km 7

1 332 georeferenced · 52 without coordinates

Open the mapobservation + sensor1 384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 58≤1 km 100≤10 km 92>10 km 43

293 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	134
University of Alberta Museums (UAM)location not on record	49
Tartu, EE	33
DanishLepidopterologicalSocietylocation not on record	23
NHMOlocation not on record	17
SLU Artdatabankenlocation not on record	16
Kuopio, FI	12
Royal Saskatchewan Museumlocation not on record	9
Washington, US	8
Essig Museum of Entomologylocation not on record	8
New Haven, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Rovaniemi, FI	4
East Lansing, US	4
DABUHlocation not on record	3
ZSMlocation not on record	2
Philadelphia, US	2
ZAF-UMUlocation not on record	2
Cambridge, US	1
Metsähallituslocation not on record	1
Provincia di Livornolocation not on record	1
Nijmegen, NL	1
Santa Barbara Museum of Natural Historylocation not on record	1
University of Oulu, Zoological Museumlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
SOVTlocation not on record	1

26 institutions · 344 of 392 vouchered records shown · 48 without an institution code

09Environmental DNA49 detections

Where the DNA of Apomyelois bistriatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map9 countries0

Mixed HabitatForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 12.4–18.8

Seasonal swing summer↔winter19.8 °C

Max temp (day)20.3 °C 16.8–23.8

Min temp (night)11.4 °C 7.00–14.7

Precipitation92.1 mm/mo 17.3–131

Air humidity59.9 % 57.4–61.8

Moisture balance-24.8 mm/mo -105–60.6

Vapour deficit718 Pa 554–881

Wind speed2.70 m/s 2.00–4.10

Cloud cover37.7 % 30.8–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apomyelois bistriatella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 779 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 779 records