Apolygus limbatus

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Apolygus

At a glance

Occurrence records486

Data sources6

Biological traits0

DNA specimens10

eDNA detections9

Sources6 archives

Databases and archives Apolygus limbatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF486 records

Environmental DNA2 datasets · 4 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

De Rooddijschaduwwants is een wants uit de familie van de blindwantsen (Miridae). De soort werd het eerst wetenschappelijk beschreven door Carl Fredrik Fallén in 1807.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apolygus limbatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)0.88%

Haplotypes1

BINs2

Where individuals differ — all 26 variable positions, in barcode order

112Tmostly conserved

133Tmostly conserved

181Amostly conserved

202Amostly conserved

217Tmostly conserved

226Tmostly conserved

229Gmostly conserved

250Cmostly conserved

260Cmostly conserved

281Gmostly conserved

340Cmostly conserved

343Cmostly conserved

361Cmostly conserved

373Gmostly conserved

415Gmostly conserved

416Gmostly conserved

427Tmostly conserved

433Amostly conserved

469Amostly conserved

485Gmostly conserved

486Cmostly conserved

535Gmostly conserved

536Cmostly conserved

541Amostly conserved

571Tmostly conserved

617Tmostly conserved

CACCCTATATTTCATCTTTGGGATATGGGCAGGAATATTAGGATCATCATTAAGATGAATTATTCGAATTGAATTAGGAATACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apolygus lucorumsame genus3.6%Apolygus subhilarissame genus3.9%Apolygus watajiisame genus3.9%Apolygus spinolaesame genus4.0%Apolygus roseofemoralissame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type486 records

Wild obs. + sensor304

Museum / vouchered162

Other20

Range

Area of Occupancy AOO1 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 62≤1 km 49≤10 km 39>10 km 11

161 georeferenced · 143 without coordinates

Open the mapobservation + sensor304

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 42≤1 km 74≤10 km 21

137 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Aarhus Denmarklocation not on record	19
Philadelphia, US	10
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	4
NHMOlocation not on record	3
SLU Artdatabankenlocation not on record	3
ZMAAlocation not on record	3
Forssa, FI	3
Helsinki, FI	2
Jyväskylä, FI	2
National Institute of Biological Resourceslocation not on record	1
Tartu, EE	1
NTNU, University Museumlocation not on record	1

12 institutions · 52 of 162 vouchered records shown · 110 without an institution code

09Environmental DNA9 detections

Where the DNA of Apolygus limbatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys2

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.4–17.8

Seasonal swing summer↔winter18.2 °C

Max temp (day)20.2 °C 17.2–21.5

Min temp (night)12.5 °C 9.80–13.2

Precipitation92.3 mm/mo 81.7–114

Air humidity60.7 % 58.2–64.7

Moisture balance-7.90 mm/mo -26.6–19.6

Vapour deficit759 Pa 545–800

Wind speed2.20 m/s 2.10–2.40

Cloud cover42.1 % 37.2–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)