Apollophanes margareta

Lowrie & Gertsch, 1955 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Philodromidae/Apollophanes

At a glance

Occurrence records89

Data sources8

Biological traits3

DNA specimens21

eDNA detections21

Sources8 archives

Databases and archives Apollophanes margareta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Apollophanes margareta is a species of running crab spider in the family Philodromidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1978

Morphometry3

Body length♀7.75·♂6.8 mm

Cephalothorax length♀3.11·♂2.67 mm

Cephalothorax width♀2.98·♂2.58 mm

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apollophanes margareta has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

274Tmostly conserved

352Tmostly conserved

466Amostly conserved

514Avariable

532Avariable

586Gmostly conserved

592Tmostly conserved

616Cvariable

625Tmostly conserved

628Tmostly conserved

637Tvariable

AACGTTATATTTAATTTTTGGTGCATGGGCTGCTATAGTGGGAACAGCAATAAGTGTATTAATTCGAATAGAGTTGGGACAAGTAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes8

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tibellus maritimussame family11.7%Thanatus oblongiusculussame family12.0%Tibellus oblongussame family12.2%Suemus punctatussame family13.0%Plexippus paykullisame order13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type89 records

Wild obs. + sensor46

Museum / vouchered43

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 26≤1 km 3≤10 km 4>10 km 6

39 georeferenced · 7 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 2≤10 km 3>10 km 2

7 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Cambridge, US	1
Vancouver, CA	1
Albuquerque, US	1

5 institutions · 32 of 43 vouchered records shown · 11 without an institution code

09Environmental DNA21 detections

Where the DNA of Apollophanes margareta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

Mixed Habitat4. Native Grassland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland | 1.4. Temperate ForestForest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 10.1–20.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)21.4 °C 15.7–26.6

Min temp (night)10.0 °C 3.90–13.6

Precipitation46.2 mm/mo 31.4–103

Air humidity52.3 % 49.1–56.3

Moisture balance-71.1 mm/mo -122–-13.4

Vapour deficit824 Pa 553–1,212

Wind speed2.10 m/s 1.50–2.80

Cloud cover37.9 % 32.4–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)