Apollonias barbujana

(Cav.) A.Braun · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Apollonias

At a glance

Occurrence records62

Data sources11

Biological traits0

DNA specimens7

eDNA detections9

Sources11 archives

Databases and archives Apollonias barbujana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS124 compounds

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Apollonias barbujana est une espèce de plantes à fleurs de la famille des Lauracées. C'est un arbre au feuillage persistant originaire des Açores, de Madère et des îles Canaries. Il peut atteindre une hauteur de 25 m. Il a de petites fleurs blanc verdâtre qui fleurissent d'octobre à mai, et des fruits de couleur noire à maturité. Le bois, lourd et dur, est difficile à travailler, mais a été utilisé pour la construction navale et aussi dans la fabrication d’ustensiles agricoles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition124 compounds

Compounds documented for Apollonias barbujana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives18

Flavones14

Acyclic monoterpenoids8

Menthane monoterpenoids8

Menthane monoterpenoids $ Monocyclic monoterpenoids8

Documented compounds124 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Menthol	present	NPASS
(+)-Perillyl alcohol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(-)-alpha-Pinene	present	NPASS
(-)-Camphene	present	NPASS
(-)-Caryophyllene	present	NPASS
(-)-Linalool	present	NPASS
(-)-Menthol	present	NPASS
(2E)-1-(3-Furanyl)-4-methyl-2-penten-1-one	present	NPASS
(2R)-3-(3,4-dihydroxyphenyl)-2-hydroxypropanamide	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apollonias barbujana has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLPP682614.1 ↗380 bpKyrgyzstan

ACGT

CTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTGCTGGGGAGGAAAGTCAATTTATTGCCTATGTAGCTTAC …

Persea barbujana voucher KAUMB24 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Apollonias barbujana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–422n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · iber-fl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-fedorov — Bambacioni-Mezzetti 1940 (D. 1955)

CCDB · book-atlas-flowering-plants — Bambacioni 1940

2n 421×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Battaglia 1947c

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type62 records

Wild obs. + sensor49

Museum / vouchered13

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 18≤1 km 26

44 georeferenced · 5 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	6
Kew, GB	1
Zürich, CH	1
Görlitz, DE	1

4 institutions · 9 of 13 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Apollonias barbujana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.8–15.3

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C 16.0–20.3

Min temp (night)9.00 °C 6.80–9.70

Precipitation33.4 mm/mo 33.4–64.2

Air humidity52.9 % 52.9–60.9

Moisture balance-61.7 mm/mo -61.7–-16.1

Vapour deficit953 Pa 626–953

Wind speed2.00 m/s 2.00–3.30

Cloud cover38.3 % 38.3–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)