Apohyale prevostii

(H.Milne Edwards, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Hyalidae/Apohyale

At a glance

Occurrence records1 468

Data sources8

Biological traits0

DNA specimens68

eDNA detections300

Sources8 archives

Databases and archives Apohyale prevostii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility712 records↗

OBISOcean Biodiversity Information System756 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI300 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS1 468 records

Environmental DNA3 datasets · 7 countries300 detections

DNA & barcodingBOLD68 specimens

Genome at a glanceGoaT2n = 50

01Narrative

Apohyale prevostii is een vlokreeftensoort uit de familie van de Hyalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1830 door Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apohyale prevostii has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes2

eDNA detections300

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

290Cmostly conserved

340Tmostly conserved

GACTCTCTATTTTATTTTAGGTGCTTGAGCAAGGGTTATTGGTACCTCTTTCAGAGTTATTATTCGATCAGAATTAAGTGCACCTGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes7

BIN1

Most divergent pair0.30%

N.AmericaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Orchestoidea tuberculatasame order15.9%Haploops tubicolasame order17.0%Megalorchestia pugettensissame order17.6%Niphargus rhenorhodanensissame order17.7%Niphargus kenkisame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Apohyale prevostii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 501×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 468 records

Wild obs. + sensor520

Museum / vouchered797

Other151

Range

Area of Occupancy AOO1 996 km²

Depth

0–200 m sunlit50

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 2.1 m · max 560 m · 52 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 413≤1 km 20≤10 km 32

465 georeferenced · 55 without coordinates

Open the mapobservation + sensor520

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 43≤1 km 33≤10 km 18>10 km 2

96 georeferenced · 701 without coordinates

Open the institutions mapphysical evidence797

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	22
Stockholm, SE	20
Bergen, NO	17
Cambridge, US	10
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	9
Auckland, NZ	9
Citadel Hill, GB	7
PNHSlocation not on record	6
Tromsø, NO	5
630location not on record	5
NTNU-VMlocation not on record	5
486location not on record	3
Helsinki, FI	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
New Haven, US	3
Brussels, BE	3
Institut Francais pour l'Etude de la Merlocation not on record	3
RWSlocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	1
Tromso University Museumlocation not on record	1
Toronto, CA	1
RBINS-Scientific Heritagelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

24 institutions · 141 of 797 vouchered records shown · 6 without an institution code

09Environmental DNA300 detections

Where the DNA of Apohyale prevostii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found300

Studies independent surveys3

Countries7

Verifiable raw sequence linked230

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 300 detections have coordinates

Open the map7 countries0

Rocky shoreintertidal: mud flat with boulders and seawe…Marina wallrocky shore with tide pools and seaweeds

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C -2.80–17.4

Seasonal swing summer↔winter23.4 °C

Max temp (day)15.4 °C 0.9–21.1

Min temp (night)11.0 °C -6.10–15.5

Precipitation107 mm/mo 88.9–130

Air humidity62.4 % 60.3–65.7

Moisture balance38.8 mm/mo -41.6–137

Vapour deficit530 Pa 197–700

Wind speed4.60 m/s 1.80–7.20

Cloud cover53.8 % 47.1–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 292 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apohyale prevostii

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 468 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 468 records