Apohyale perieri

(Lucas, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Hyalidae/Apohyale

At a glance

Occurrence records163

Data sources7

Biological traits2

DNA specimens21

eDNA detections22

Sources7 archives

Databases and archives Apohyale perieri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 records↗

OBISOcean Biodiversity Information System55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS163 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD21 specimens

01Narrative

Apohyale perieri is een vlokreeftensoort uit de familie van de Hyalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1849 door Lucas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apohyale perieri has left across the world's sequence archives.

At a glance

DNA specimens21

BINs4

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P550 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

4Cmostly conserved

13Cvariable

37Tvariable

40Cmostly conserved

52Cvariable

55Gmostly conserved

58Amostly conserved

67Avariable

70Tmostly conserved

73Amostly conserved

79Amostly conserved

97Cmostly conserved

103Tmostly conserved

109Gmostly conserved

112Gmostly conserved

115Tmostly conserved

118Tmostly conserved

133Tmostly conserved

136Tvariable

163Amostly conserved

169Gmostly conserved

178Tvariable

181Cvariable

199Amostly conserved

200Gmostly conserved

202Cmostly conserved

214Gvariable

217Gvariable

220Cmostly conserved

235Tmostly conserved

241Tvariable

259Tmostly conserved

263Cmostly conserved

271Tvariable

274Tvariable

277Amostly conserved

278Cmostly conserved

280Tmostly conserved

283Tmostly conserved

295Gvariable

310Gvariable

316Tmostly conserved

322Cvariable

328Gmostly conserved

331Amostly conserved

337Tvariable

340Cmostly conserved

343Gvariable

355Gmostly conserved

358Tmostly conserved

361Gvariable

382Tmostly conserved

386Cmostly conserved

388Gvariable

397Cmostly conserved

400Tvariable

409Tvariable

421Cmostly conserved

433Gmostly conserved

451Gvariable

457Tmostly conserved

466Gvariable

470Gmostly conserved

472Cmostly conserved

481Amostly conserved

484Tmostly conserved

490Tvariable

496Cmostly conserved

499Amostly conserved

500Cvariable

508Tmostly conserved

520Cmostly conserved

533Cmostly conserved

535Tmostly conserved

541Cvariable

544Cvariable

TTCCTTATATTTCATTTTGGGGGCATGAGCAAGAGTTCTCGGAACTTCACTCAGGGTAATTATTCGATCTGAACTGAGAGCCCCAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes10

BINs4

Most divergent pair11.6%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type163 records

Wild obs. + sensor21

Museum / vouchered75

Other67

Range

Area of Occupancy AOO404 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 13.5 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 17 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 1≤1 km 15≤10 km 2>10 km 1

19 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Simón Bolívarlocation not on record	6
DASSHlocation not on record	4
Citadel Hill, GB	3
Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record	3
Brussels, BE	2
AUTHlocation not on record	2
Cambridge, US	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Station Biologique de Roscoff (EDMO:521)location not on record	1
Auckland, NZ	1
RBINS-Scientific Heritagelocation not on record	1

11 institutions · 25 of 75 vouchered records shown · 22 without an institution code

09Environmental DNA22 detections

Where the DNA of Apohyale perieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Rocky shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 15.9–19.8

Seasonal swing summer↔winter7.60 °C

Max temp (day)20.2 °C 18.2–22.2

Min temp (night)17.1 °C 14.0–19.2

Precipitation43.0 mm/mo 2.30–57.1

Air humidity63.1 % 55.9–68.3

Moisture balance-91.3 mm/mo

Vapour deficit762 Pa 631–1,024

Wind speed3.60 m/s

Cloud cover38.1 % 32.0–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)