Apohyale anceps

(J.L.Barnard, 1969) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Hyalidae/Apohyale

At a glance

Occurrence records50

Data sources6

Biological traits1

DNA specimens14

eDNA detections8

Sources6 archives

Databases and archives Apohyale anceps's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

OBISOcean Biodiversity Information System5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS50 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD14 specimens

01Narrative

Apohyale anceps is een vlokreeftensoort uit de familie van de Hyalidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1969 door J.L. Barnard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apohyale anceps has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Diversity (π)4.7%

Haplotypes1

BINs4

Where individuals differ — all 137 variable positions, in barcode order

3Cmostly conserved

4Tmostly conserved

6Amostly conserved

9Cmostly conserved

15Amostly conserved

16Cmostly conserved

21Tmostly conserved

24Tmostly conserved

27Amostly conserved

28Gmostly conserved

33Gmostly conserved

37Gmostly conserved

39Amostly conserved

42Tmostly conserved

45Cmostly conserved

48Amostly conserved

54Amostly conserved

57Avariable

63Cmostly conserved

66Gmostly conserved

72Gmostly conserved

73Tmostly conserved

75Amostly conserved

78Gmostly conserved

81Avariable

84Cmostly conserved

87Tmostly conserved

90Tmostly conserved

96Cmostly conserved

99Cmostly conserved

102Tmostly conserved

114Cmostly conserved

117Cmostly conserved

129Tmostly conserved

132Amostly conserved

135Tmostly conserved

144Gmostly conserved

159Gmostly conserved

165Amostly conserved

180Tmostly conserved

183Cmostly conserved

189Gvariable

192Cmostly conserved

198Tmostly conserved

201Tmostly conserved

210Amostly conserved

219Gvariable

225Tmostly conserved

228Gmostly conserved

231Avariable

246Tmostly conserved

249Tvariable

264Amostly conserved

265Cmostly conserved

267Amostly conserved

270Tmostly conserved

276Amostly conserved

279Amostly conserved

282Tmostly conserved

285Gmostly conserved

300Cmostly conserved

301Tmostly conserved

303Amostly conserved

315Amostly conserved

318Tmostly conserved

333Tmostly conserved

336Amostly conserved

339Cmostly conserved

348Gmostly conserved

349Gmostly conserved

354Amostly conserved

355Gmostly conserved

357Tvariable

358Amostly conserved

366Tmostly conserved

372Amostly conserved

385Tmostly conserved

396Cmostly conserved

400Cmostly conserved

402Tmostly conserved

405Tmostly conserved

406Tmostly conserved

408Gmostly conserved

411Cmostly conserved

414Gmostly conserved

417Tmostly conserved

420Avariable

432Cmostly conserved

441Tmostly conserved

447Cmostly conserved

453Cmostly conserved

456Cmostly conserved

459Cmostly conserved

462Tmostly conserved

465Amostly conserved

471Amostly conserved

474Gmostly conserved

477Tmostly conserved

478Amostly conserved

480Amostly conserved

492Gmostly conserved

495Cmostly conserved

507Cmostly conserved

510Amostly conserved

513Cmostly conserved

516Tmostly conserved

519Tmostly conserved

529Amostly conserved

532Tmostly conserved

534Amostly conserved

537Amostly conserved

538Cmostly conserved

540Tmostly conserved

541Tmostly conserved

543Amostly conserved

546Gvariable

555Amostly conserved

561Amostly conserved

564Amostly conserved

567Tmostly conserved

+17 more variable positions not shown

ACCTTATACTTTATACTAGGTGCTTGAGCCAGGGTCGTAGGTACCTCATTAAGAGTAATTATCCGGTCTGAGTTAAGGGCACCCGGTAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Orchestia mediterraneasame order16.1%Talitroides alluaudisame order17.0%Awacaris yezoensissame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type50 records

Museum / vouchered50

Range

Area of Occupancy AOO100 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.2 m · max 0.2 m · 1 record with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence50

10Collections & institutions

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	38
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Stanford Universitylocation not on record	1

5 institutions · 44 of 50 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Apohyale anceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Scarp/Wall, Mussel Reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 9.60–12.4

Seasonal swing summer↔winter14.9 °C

Max temp (day)15.2 °C 12.0–15.8

Min temp (night)7.70 °C 6.80–9.70

Precipitation138 mm/mo 135–172

Air humidity63.1 % 62.6–65.5

Moisture balance43.6 mm/mo 43.6–84.5

Vapour deficit501 Pa 441–501

Wind speed1.10 m/s 1.10–4.40

Cloud cover39.8 % 38.9–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)