Apogonichthys perdix

Bleeker, 1854 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogonichthys

At a glance

Occurrence records327

Data sources7

Biological traits6

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Apogonichthys perdix's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

OBISOcean Biodiversity Information System192 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS327 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Apogonichthys perdix is een straalvinnige vissensoort uit de familie van kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1854 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max65 m

Depth min1 m

Vulnerability10

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogonichthys perdix has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Diversity (π)7.6%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 115 variable positions, in barcode order

22Cvariable

28Tvariable

31Amostly conserved

40Tmostly conserved

43Amostly conserved

55Tmostly conserved

58Tmostly conserved

64Gmostly conserved

67Tmostly conserved

85Cmostly conserved

88Cmostly conserved

89Cmostly conserved

91Tmostly conserved

94Cmostly conserved

97Amostly conserved

118Cmostly conserved

124Tmostly conserved

127Cmostly conserved

139Cmostly conserved

145Gmostly conserved

172Gmostly conserved

184Cmostly conserved

187Gmostly conserved

202Cmostly conserved

214Gmostly conserved

223Cmostly conserved

226Gmostly conserved

229Tmostly conserved

238Tmostly conserved

247Tmostly conserved

256Cmostly conserved

262Amostly conserved

268Tmostly conserved

271Tmostly conserved

274Amostly conserved

277Tmostly conserved

286Cmostly conserved

289Amostly conserved

298Cmostly conserved

300Cmostly conserved

301Gmostly conserved

304Amostly conserved

307Amostly conserved

310Tmostly conserved

313Amostly conserved

319Cmostly conserved

325Amostly conserved

328Gmostly conserved

331Amostly conserved

334Tmostly conserved

343Amostly conserved

344Cmostly conserved

346Gmostly conserved

355Tmostly conserved

358Tmostly conserved

361Cmostly conserved

367Amostly conserved

370Gmostly conserved

376Amostly conserved

383Tmostly conserved

385Amostly conserved

391Cmostly conserved

397Cmostly conserved

403Tmostly conserved

404Tmostly conserved

406Amostly conserved

412Amostly conserved

415Cmostly conserved

425Cmostly conserved

427Tmostly conserved

433Amostly conserved

439Tmostly conserved

445Cmostly conserved

448Cmostly conserved

451Tmostly conserved

454Tmostly conserved

463Amostly conserved

478Cmostly conserved

481Cmostly conserved

484Amostly conserved

487Cmostly conserved

493Cmostly conserved

496Tmostly conserved

499Tmostly conserved

502Cmostly conserved

511Tmostly conserved

514Amostly conserved

536Cmostly conserved

538Tmostly conserved

539Tmostly conserved

541Amostly conserved

547Tmostly conserved

550Cmostly conserved

556Gmostly conserved

565Amostly conserved

574Amostly conserved

577Cmostly conserved

580Cvariable

583Amostly conserved

586Tmostly conserved

589Tmostly conserved

593Tmostly conserved

595Amostly conserved

601Amostly conserved

604Amostly conserved

616Amostly conserved

619Cmostly conserved

622Amostly conserved

625Cmostly conserved

628Gmostly conserved

631Tmostly conserved

634Tmostly conserved

649Cmostly conserved

650Tmostly conserved

652Amostly conserved

CCTTTATCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGTACAGCTCTTAGCCTTCTTATCCGGGCTGAACTAAGCCAGCCCGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stegastes acapulcoensissame order16.0%Lepidotrigla multispinosasame order16.4%Stegastes rocasensissame order16.6%Ostorhinchus septemstriatussame family16.6%Neosebastes longirostrissame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type327 records

Wild obs. + sensor41

Museum / vouchered284

Other2

Range

Area of Occupancy AOO488 km²

Depth

0–200 m sunlit46

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3.5 m · max 41 m · 46 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 2≤10 km 2>10 km 2

8 georeferenced · 33 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 21≤1 km 19≤10 km 7>10 km 10

57 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	40
South African Institute for Aquatic Biodiversitylocation not on record	20
Toronto, CA	14
Sydney, AU	11
CASlocation not on record	8
Western Australian Museumlocation not on record	5
Auckland, NZ	4
Museum and Art Gallery of the Northern Territorylocation not on record	3
Paris, FR	2
Honolulu, US	2
Chicago, US	2
	2
Cambridge, US	1
Frankfurt am Main	1

14 institutions · 115 of 284 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Apogonichthys perdix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.0–26.0

Seasonal swing summer↔winter2.60 °C

Max temp (day)25.7 °C 23.7–26.6

Min temp (night)24.4 °C 22.5–25.3

Precipitation139 mm/mo 122–165

Air humidity61.2 % 61.0–62.4

Moisture balance-14.2 mm/mo

Vapour deficit1,203 Pa 1,094–1,290

Wind speed5.50 m/s

Cloud cover18.0 % 17.3–27.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)