Apogonichthyoides brevicaudatus

(Weber, 1909) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogonichthyoides

At a glance

Occurrence records982

Data sources8

Biological traits6

DNA specimens8

eDNA detections6

Sources8 archives

Databases and archives Apogonichthyoides brevicaudatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility446 records↗

OBISOcean Biodiversity Information System536 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS982 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Apogonichthyoides brevicaudatus is een straalvinnige vissensoort uit de familie van de kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1909 door Weber.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length19.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Other traits3

Depth max35 m

Depth min10 m

Vulnerability10

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogonichthyoides brevicaudatus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 8 variable positions, in barcode order

106Gmostly conserved

305Gmostly conserved

310Cmostly conserved

491Amostly conserved

505Amostly conserved

550Tmostly conserved

565Gmostly conserved

601Amostly conserved

CCTCTATCTAGTATTTGGTGCATGAGCCGGCATGGTCGGGACCGCCCTTAGCCTACTTATCCGGGCTGAGCTGAGCCAGCCTGGAGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhabdamia spilotasame family13.9%Jaydia novaeguineaesame family14.1%Apogonichthyoides melassame genus14.4%Ostorhinchus disparsame family15.6%Ostorhinchus semilineatussame family15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type982 records

Wild obs. + sensor171

Museum / vouchered339

Cultivated / captive472

Range

Area of Occupancy AOO776 km²

Depth

0–200 m sunlit189

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 25.9 m · max 60 m · 189 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 12≤1 km 158>10 km 1

171 georeferenced

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 23≤1 km 86≤10 km 54>10 km 19

182 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence339

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 472

472 georeferenced

Open the mapnot free-living472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	44
Natick, US	30
DEWlocation not on record	20
Western Australian Museumlocation not on record	19
Sydney, AU	15
Museum and Art Gallery of the Northern Territorylocation not on record	10
CSIRO, Australian National Fish Collectionlocation not on record	2
Museums Victorialocation not on record	1
Washington, US	1

9 institutions · 142 of 339 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Apogonichthyoides brevicaudatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 24.1–27.2

Seasonal swing summer↔winter7.40 °C

Max temp (day)28.2 °C 24.9–29.0

Min temp (night)25.1 °C 23.1–25.8

Precipitation118 mm/mo 37.4–278

Air humidity61.5 % 58.3–63.7

Vapour deficit1,374 Pa 1,178–1,383

Cloud cover37.2 % 18.4–65.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)