Apogon retrosella

(Gill, 1862) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogon

At a glance

Occurrence records1 242

Data sources10

Biological traits6

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Apogon retrosella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility843 records↗

OBISOcean Biodiversity Information System399 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 242 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT · NCBI≈950 Mbp

01Narrative

Apogon retrosella is een straalvinnige vissensoort uit de familie van kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1862 door Gill. De soort staat op de Rode Lijst van de IUCN als niet bedreigd, beoordelingsjaar 2008.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceof no interest

Other traits2

Depth max60 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogon retrosella has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

247Tvariable

457Cvariable

619Tvariable

625Gvariable

CACCCTTTATCTAGTATTCGGTGCCTGAGCTGGAATGGTGGGGACGGCCCTAAGCCTGCTCATTCGAGCCGAGCTAAGCCAGCCCGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogon doviisame genus2.9%Apogon imberbissame genus9.8%Apogon americanussame genus10.4%Apogon maculatussame genus10.4%Apogon pseudomaculatussame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apogon retrosella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈950 009 857 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apogon retrosella0.95 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 242 records

Wild obs. + sensor155

Museum / vouchered1 087

Origin

Native105

Range

Area of Occupancy AOO1 960 km²

Depth

0–200 m sunlit55

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 31.5 m · 55 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 36≤1 km 25≤10 km 1>10 km 16

78 georeferenced · 77 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 68≤1 km 39≤10 km 93>10 km 21

221 georeferenced · 866 without coordinates

Open the institutions mapphysical evidence1 087

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of California San Diegolocation not on record	251
Los Angeles, US	108
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	57
CASlocation not on record	57
Vancouver, CA	33
Zacatecas, MX	32
Morelia, MX	31
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	27
Washington, US	17
FishBaselocation not on record	17
Instituto Tecnológico y de Estudios Superiores de Monterrey, Campus Sonora Nortelocation not on record	16
San Francisco, US	8
New Haven, US	7
Universidad del Marlocation not on record	6
Chicago, US	5
Puebla, MX	5
Departamento para el Desarrollo Sustentable de Zonas Costeras, Centro Universitario de la Costa Sur, Universidad de Guadalajaralocation not on record	5
Moore Laboratory of Zoology, Occidental Collegelocation not on record	4
Museo de Historia Natural, Universidad Autónoma de Baja California Surlocation not on record	3
Paris, FR	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Cambridge, US	1
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	1
University of Nebraskalocation not on record	1

24 institutions · 696 of 1 087 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Apogon retrosella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter1.40 °C

Max temp (day)27.2 °C

Min temp (night)24.7 °C

Precipitation144 mm/mo

Air humidity67.9 %

Moisture balance-31.6 mm/mo

Vapour deficit1,057 Pa

Wind speed5.80 m/s

Cloud cover38.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apogon retrosella

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 242 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 242 records