Apogon erythrosoma

Gon & Randall, 2003 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogon

At a glance

Occurrence records91

Data sources7

Biological traits4

DNA specimens9

eDNA detections17

Sources7 archives

Databases and archives Apogon erythrosoma's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

OBISOcean Biodiversity Information System61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS91 records

Environmental DNA1 datasets · 3 countries17 detections

DNA & barcodingBOLD9 specimens

01Narrative

Apogon erythrosoma is een straalvinnige vissensoort uit de familie van de kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2003 door Gon & Randall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length3.76 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogon erythrosoma has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections17

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P609 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

150Tmostly conserved

312Cmostly conserved

450Cmostly conserved

465Avariable

486Gmostly conserved

GCCGGGATAGTCGGAACTGCCCTTAGCTTGCTTATTCGAGCTGAACTAAGCCAACCTGGGGCCCTCCTCGGCGACGACCAAATTTATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes4

BIN1

Most divergent pair0.33%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogon doryssasame genus9.9%Apogon lativittatussame genus12.2%Apogon semiornatussame genus12.6%Apogon coccineussame genus12.8%Apogon crassicepssame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type91 records

Wild obs. + sensor21

Museum / vouchered70

Range

Area of Occupancy AOO124 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 25 m · max 25 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 19 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤10 km 6>10 km 1

8 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	19
Frankfurt am Main	4
KAUMMlocation not on record	2
Washington, US	2
CASlocation not on record	1

5 institutions · 28 of 70 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Apogon erythrosoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 24.7–25.4

Seasonal swing summer↔winter20.7 °C

Max temp (day)30.7 °C 28.1–30.7

Min temp (night)17.3 °C 17.3–21.6

Precipitation13.0 mm/mo 13.0–39.2

Air humidity36.6 % 36.6–59.1

Moisture balance-181 mm/mo -181–-93.6

Vapour deficit2,329 Pa 1,257–2,329

Wind speed5.00 m/s 2.80–5.00

Cloud cover12.2 % 12.2–21.7

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)