Apoglossum ruscifolium

(Turner) J.Agardh · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Delesseriaceae/Apoglossum

At a glance

Occurrence records4 269

Data sources7

Biological traits1

DNA specimens40

eDNA detections17

Sources7 archives

Databases and archives Apoglossum ruscifolium's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 278 records↗

OBISOcean Biodiversity Information System1 991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS4 269 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD · NCBI40 specimens

01Narrative

Apoglossum ruscifolium is a small red marine seaweed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apoglossum ruscifolium has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes3

GenBank sequences2

eDNA detections17

The DNA barcodea real sequence read deposited for this species

rbcLAF312310.1 ↗1 440 bpUnited Kingdom

ACGT

CAGGTTAAAAATGAGCGTTATGAATCTGGTGTAATTCCATATGCAAAAATGGGATATTGGGAGCCAGATTACGTAATTAAAGAGACTGAT …

Apoglossum ruscifolium ribulose-1,5-bisphosphate carboxylase gene, partial cds; chloroplast gene for chloroplast product

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dasya tenuissame family11.3%Myriogramme smithiisame family11.7%Deltalsia parasiticasame order11.9%Dasysiphonia japonicasame family12.0%Thuretia quercifoliasame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL228S-D2

animal barcodeplant barcodemarker

08Occurrence & distribution

Record type4 269 records

Wild obs. + sensor1 129

Museum / vouchered1 500

Other1 640

Origin

Native70

Range

Area of Occupancy AOO4 032 km²

Depth

0–200 m sunlit902

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 13.4 m · max 40 m · 902 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 848≤1 km 141≤10 km 56

1 045 georeferenced · 84 without coordinates

Open the mapobservation + sensor1 129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 61≤1 km 110≤10 km 65>10 km 16

252 georeferenced · 1 248 without coordinates

Open the institutions mapphysical evidence1 500

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	176
486location not on record	117
Clocation not on record	96
730location not on record	69
KMNlocation not on record	26
LDlocation not on record	24
DASSHlocation not on record	24
South Kensington, GB	23
Museum national d'Histoire naturellelocation not on record	23
PNHSlocation not on record	22
Ann Arbor, US	19
Chapel Hill, US	15
Uppsala, SE	11
Barcelona, ES	6
Durham, US	5
MeiseBGlocation not on record	5
Acadia Universitylocation not on record	4
GRAlocation not on record	3
Universidad de Oviedolocation not on record	3
Museo Entomologico de Leonlocation not on record	3
Burlington, US	3
Auckland, NZ	2
Bronx, US	2
València, ES	2
UAclocation not on record	2
Bourges, FR	2
Tampa, US	2
University of Stellenboschlocation not on record	1
BDBClocation not on record	1
ISAlocation not on record	1
Marine Biological Association of the UKlocation not on record	1
CIBIOlocation not on record	1
Vancouver, CA	1
GENTlocation not on record	1
Cape Town, ZA	1
San Diego, US	1
SLU Artdatabankenlocation not on record	1
Madrid, ES	1
Trondheim, NO	1
RUGlocation not on record	1

40 institutions · 702 of 1 500 vouchered records shown · 133 without an institution code

09Environmental DNA17 detections

Where the DNA of Apoglossum ruscifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

Rocky shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 8.70–13.9

Seasonal swing summer↔winter8.50 °C

Max temp (day)10.4 °C 9.70–15.2

Min temp (night)8.70 °C 7.70–12.6

Precipitation75.8 mm/mo 53.1–82.5

Air humidity63.1 % 61.4–65.5

Moisture balance1.90 mm/mo

Vapour deficit439 Pa 423–553

Wind speed6.60 m/s

Cloud cover47.2 % 41.9–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apoglossum ruscifolium

At a glance

Sources7 archives

Habitat & environment1

At a glance

Record type4 269 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 269 records