Apodia bifractella

(Duponchel, 1843) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Apodia

At a glance

Occurrence records938

Data sources7

Biological traits2

DNA specimens62

eDNA detections58

Sources7 archives

Databases and archives Apodia bifractella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility938 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF938 records

Environmental DNA1 datasets · 8 countries58 detections

DNA & barcodingBOLD62 specimens

01Narrative

Apodia bifractella is a moth of the family Gelechiidae. It is found in most of Europe, as well as Turkey, the Caucasus and North Africa.et al. 2010: The gelechiid fauna of the southern Ural Mountains, part II: list of recorded species with taxonomic notes (Lepidoptera: Gelechiidae). Zootaxa, 2367: 1–68. Preview A sprig of Inula conyza (1b), and seeds fastened together and bored by the larva (1b*) Larva The wingspan is 9–12 mm. Adults are on wing from July to August.UKmoths The larvae feed on Pulicaria dysenterica, Inula conyzae and Aster tripolium. They feed within the seedheads of their host plant. Larvae can be found from October to April. They are shaped as Diptera larva and are translucent off-white with an off-white head. The species overwinters in the larval stage. Pupation takes place within the seedhead.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apodia bifractella has left across the world's sequence archives.

At a glance

DNA specimens62

BINs1

Marker genes1

eDNA detections58

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

100Tmostly conserved

202Amostly conserved

208Gmostly conserved

238Cmostly conserved

415Avariable

478Amostly conserved

508Amostly conserved

535Tmostly conserved

622Tmostly conserved

641Tvariable

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGTCTACTAATTCGAGCTGAACTTGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes18

BIN1

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apodia martiniisame genus6.4%Eurrhypis guttulalissame order8.7%Glyphodes bicolorsame order8.8%Glyphodes apiospilasame order8.8%Glyphodes flavizonalissame order9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type938 records

Wild obs. + sensor827

Museum / vouchered86

Other25

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 168≤1 km 105≤10 km 492>10 km 2

767 georeferenced · 60 without coordinates

Open the mapobservation + sensor827

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 11≤1 km 38≤10 km 1

50 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	20
Provincia di Livornolocation not on record	12
SLU Artdatabankenlocation not on record	11
Stockholm, SE	5
National Institute of Biological Resourceslocation not on record	2
South Kensington, GB	2
Natural History Museum, Londonlocation not on record	2
NHMOlocation not on record	2
Tilburg, NL	2
Salzburg, AT	1
Nijmegen, NL	1
University of Oslo, Natural History Museumlocation not on record	1
Research Collection of Thomas Guggemooslocation not on record	1
Landesmuseum Kaerntenlocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1

15 institutions · 64 of 86 vouchered records shown · 22 without an institution code

09Environmental DNA58 detections

Where the DNA of Apodia bifractella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map8 countries0

forestscrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 9.70–21.2

Seasonal swing summer↔winter19.2 °C

Max temp (day)20.0 °C 14.2–25.8

Min temp (night)9.50 °C 3.90–16.5

Precipitation125 mm/mo 56.0–392

Air humidity59.7 % 56.3–65.3

Moisture balance-0.2 mm/mo -65.4–271

Vapour deficit695 Pa 419–1,093

Wind speed3.50 m/s 2.00–3.60

Cloud cover36.0 % 32.1–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)