Apodasmia similis

(Edgar) B.G.Briggs & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Restionaceae/Apodasmia

At a glance

Occurrence records2 875

Data sources11

Biological traits27

DNA specimens3

eDNA detections4

Sources11 archives

Databases and archives Apodasmia similis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 875 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF2 875 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Apodasmia similis, also known as oioi or jointed wire rush, is a plant that is endemic to New Zealand. It is a coastal plant but is also found around peat bogs and hot springs. It flowers from October to December and bears fruit from December to March.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Fruit length1 mm

Fruit width5 mm

Plant height1 m

Plant height max1.5 m

Seed mass0.382 mg

Seed mass max0.38 mg

Seed mass min0.38 mg

Life cycle & reproduction9

Deciduousnessn.d.

⚠ sources differ — TRY: n.d. · GIFT: evergreen

Dispersal type detailedanemochorous

Life formrhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formcryptophyte

Reproduction asexualpresent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apodasmia similis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ933222.1 ↗1 383 bpNew Zealand

ACGT

GTGTGGATTTAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTAGCAGCATT …

Apodasmia similis voucher CHR517317 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Apodasmia similis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Briggs, B. G. 2000. In M. I. Dawson, Index of chromosome numbers of indigenous New Zealand spermatophytes. New Zealand J. Bot. 38: 47–150.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 875 records

Wild obs. + sensor2 450

Museum / vouchered424

Fossil1

Origin

Introduced5

Range

Area of Occupancy AOO4 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 065≤1 km 140≤10 km 37>10 km 28

1 270 georeferenced · 1 180 without coordinates

Open the mapobservation + sensor2 450

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 10≤1 km 23≤10 km 15>10 km 6

54 georeferenced · 370 without coordinates

Open the institutions mapphysical evidence424

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	180
Auckland, NZ	108
Wellington, NZ	86
Museo Entomologico de Leonlocation not on record	15
Rotorua, NZ	15
John T. Waterhouse Herbariumlocation not on record	5
Hobart, AU	5
Palmerston North, NZ	4
Moscow State Universitylocation not on record	1
MAlocation not on record	1
Armidale, AU	1
Canberra, AU	1

12 institutions · 422 of 424 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Apodasmia similis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apodasmia similis

At a glance

Sources11 archives

Size & morphology7

Life cycle & reproduction9

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 875 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 875 records