Apoda biguttata

(Packard, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Apoda

At a glance

Occurrence records2 759

Data sources7

Biological traits0

DNA specimens50

eDNA detections59

Sources7 archives

Databases and archives Apoda biguttata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 759 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 759 records

Environmental DNA1 datasets · 2 countries59 detections

DNA & barcodingBOLD50 specimens

01Narrative

Apoda biguttata, the shagreened slug moth, is a moth of the family Limacodidae. It is found in eastern North America. The wingspan is 19–30 mm. The moth flies from April to August. The larvae feed on various deciduous trees, including hornbeam, hickory and oak.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apoda biguttata has left across the world's sequence archives.

At a glance

DNA specimens50

BINs2

Marker genes2

eDNA detections59

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

23Amostly conserved

88Avariable

160Amostly conserved

172Cmostly conserved

214Amostly conserved

220Tmostly conserved

232Amostly conserved

271Tmostly conserved

340Cmostly conserved

364Cmostly conserved

400Tmostly conserved

403Cmostly conserved

412Tvariable

418Cmostly conserved

421Cvariable

448Cmostly conserved

451Tmostly conserved

472Cmostly conserved

481Amostly conserved

536Cvariable

538Amostly conserved

604Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACTTCTTTAAGTTTAATAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes15

BINs2

Most divergent pair2.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apoda maximasame genus1.7%Apoda rectilineasame genus2.0%Apoda latomiasame genus2.1%Lithacodes fasciolasame family5.5%Lithacodes graceasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 759 records

Wild obs. + sensor2 358

Museum / vouchered401

Range

Area of Occupancy AOO5 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 177≤1 km 422≤10 km 138>10 km 173

1 910 georeferenced · 448 without coordinates

Open the mapobservation + sensor2 358

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 9≤1 km 23≤10 km 139>10 km 47

218 georeferenced · 183 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	101
East Lansing, US	63
New Haven, US	62
Cambridge, US	49
CUlocation not on record	21
Georgia Museum of Natural Historylocation not on record	19
St. Paul, US	17
Cleveland Museum of Natural History, OH (CLEV)location not on record	15
University of Guelphlocation not on record	7
Toronto, CA	7
Washington, US	6
Cornell University Insect Collectionlocation not on record	4
King Saud Universitylocation not on record	3
Texas A&M University, College Stationlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
University of Alberta Museums (UAM)location not on record	2
San Diego, US	1
San Francisco, US	1
Denver, US	1
SOVTlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
University of California, Davislocation not on record	1
Blacksburg, US	1

23 institutions · 387 of 401 vouchered records shown · 14 without an institution code

09Environmental DNA59 detections

Where the DNA of Apoda biguttata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map2 countries0

Riparian ZoneForestMVL & UV LED sheets at edge of open grassy a…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 19.7–27.1

Seasonal swing summer↔winter10.8 °C

Max temp (day)29.1 °C 24.3–31.8

Min temp (night)19.9 °C 15.4–23.0

Precipitation133 mm/mo 84.8–238

Air humidity60.8 % 57.5–62.1

Moisture balance-19.6 mm/mo -66.6–73.2

Vapour deficit1,211 Pa 904–1,371

Wind speed2.30 m/s 1.90–4.00

Cloud cover32.8 % 28.2–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apoda biguttata

At a glance

Sources7 archives

At a glance

Record type2 759 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 759 records