Apocryptodon madurensis

(Bleeker, 1849) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Apocryptodon

At a glance

Occurrence records231

Data sources8

Biological traits9

DNA specimens19

eDNA detections5

Sources8 archives

Databases and archives Apocryptodon madurensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

OBISOcean Biodiversity Information System149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF · OBIS231 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD19 specimens

01Narrative

Apocryptodon madurensis is een straalvinnige vissensoort uit de familie van grondels (Gobiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1849 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length9 cm

Body mass7 g

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits2

Depth min0 m

Vulnerability10

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocryptodon madurensis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

4Amostly conserved

160Amostly conserved

178Gmostly conserved

202Amostly conserved

241Gmostly conserved

265Amostly conserved

278Tmostly conserved

307Amostly conserved

340Tvariable

352Cvariable

400Amostly conserved

499Gmostly conserved

514Gmostly conserved

574Gmostly conserved

CCTATACCTAATCTTTGGTGCCTGAGCCGGGATAGTGGGAACGGCCTTAAGCCTTCTCATTCGCGCTGAACTAAGTCAACCTGGGGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes11

BIN1

Most divergent pair2.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scartelaos gigassame family16.2%Parapocryptes rictuosussame family16.4%Parapocryptes serperastersame family16.5%Leptatherina wallaceisame order16.9%Periophthalmus modestussame family17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type231 records

Wild obs. + sensor13

Museum / vouchered216

Other2

Range

Area of Occupancy AOO316 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 4.6 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 8 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 4≤1 km 42≤10 km 31>10 km 6

83 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	34
Sydney, AU	16
CASlocation not on record	5
Washington, US	5
Natick, US	4
Australian National Fish Collectionlocation not on record	4
Toronto, CA	3
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Cambridge, US	1
FishBaselocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1

11 institutions · 76 of 216 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Apocryptodon madurensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)