Apocryptes bato

(Hamilton, 1822) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Apocryptes

At a glance

Occurrence records87

Data sources8

Biological traits7

DNA specimens12

eDNA detections0

Sources8 archives

Databases and archives Apocryptes bato's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

OBISOcean Biodiversity Information System41 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS87 records

DNA & barcodingBOLD12 specimens

01Narrative

Apocryptes bato is a species of mudskipper native to India, Bangladesh and Myanmar where it can be found in tropical rivers, estuaries and coastal waters of the Indian Ocean. This species can reach a length of 26 cm TL. It is of minor importance to local commercial fisheries. It is currently the only known member of its genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length26 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits1

Vulnerability16

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocryptes bato has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 59 variable positions, in barcode order

12Avariable

30Tmostly conserved

36Gmostly conserved

45Amostly conserved

48Amostly conserved

60Amostly conserved

63Cmostly conserved

66Tmostly conserved

69Gmostly conserved

72Cmostly conserved

135Gmostly conserved

150Amostly conserved

156Amostly conserved

162Amostly conserved

204Gmostly conserved

207Cmostly conserved

219Cmostly conserved

222Amostly conserved

234Cmostly conserved

237Amostly conserved

240Tmostly conserved

264Gmostly conserved

282Amostly conserved

291Amostly conserved

297Tmostly conserved

300Tmostly conserved

333Amostly conserved

339Tmostly conserved

345Cmostly conserved

351Cmostly conserved

357Tmostly conserved

366Cmostly conserved

369Amostly conserved

381Tmostly conserved

388Cmostly conserved

393Gmostly conserved

396Tmostly conserved

402Tmostly conserved

408Tmostly conserved

414Amostly conserved

423Tmostly conserved

441Tmostly conserved

465Cmostly conserved

471Amostly conserved

477Amostly conserved

478Cmostly conserved

483Tmostly conserved

492Gmostly conserved

495Gmostly conserved

513Cmostly conserved

540Tmostly conserved

541Cmostly conserved

582Tvariable

588Gvariable

594Cvariable

597Avariable

606Tvariable

612Tvariable

615Avariable

GGCACAGCCCTAAGCCTTCTAATTCGTGCTGAACTGAGCCAACCAGGAGCCCTTCTTGGAGACGATCAGATCTATAATGTAATTGTAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes5

BINs2

Most divergent pair7.9%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Periophthalmus barbarussame family13.9%Boleophthalmus dussumierisame family14.6%Scartelaos gigassame family14.6%Scartelaos tenuissame family15.1%Periophthalmus argentilineatussame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type87 records

Wild obs. + sensor29

Museum / vouchered57

Other1

Range

Area of Occupancy AOO172 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.4 m · max 0.5 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 8

9 georeferenced · 20 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤1 km 1≤10 km 7>10 km 9

18 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	6
CASlocation not on record	5
Washington, US	5
South Kensington, GB	5
Ann Arbor, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Paris, FR	1
Auckland, NZ	1
Frankfurt am Main	1

9 institutions · 30 of 57 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)