Apocorophium lacustre

(Vanhöffen, 1911) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Corophiidae/Apocorophium

At a glance

Occurrence records2 224

Data sources9

Biological traits5

DNA specimens7

eDNA detections23

Sources9 archives

Databases and archives Apocorophium lacustre's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 252 records↗

OBISOcean Biodiversity Information System972 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF · OBIS2 224 records

Environmental DNA3 datasets · 4 countries23 detections

DNA & barcodingBOLD7 specimens

01Narrative

Apocorophium lacustre is a species of amphipod crustacean. It lives in nearly fresh water; it is white and up to 6 mm long. It occurs mainly on the Atlantic coast of North America, the North Sea and the Baltic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBasePantheon

Diet & foraging1

Feeding guild (larval)saprophagous

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max10 m

Depth min0 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocorophium lacustre has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections23

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

26Tmostly conserved

52Gmostly conserved

155Tmostly conserved

182Amostly conserved

236Cmostly conserved

269Gmostly conserved

425Tmostly conserved

448Amostly conserved

539Tmostly conserved

551Tmostly conserved

581Cvariable

590Cmostly conserved

TAGTTGGCTCTTCTATAAGAGTGATTATTCGAATAGAATTAAGAGGGCCCGGAAACTTAATCGGAAACGACCAAATTTACAATGTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes7

BIN1

Most divergent pair0.96%

EuropeN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 224 records

Wild obs. + sensor671

Museum / vouchered737

Other816

Range

Area of Occupancy AOO2 988 km²

Depth

0–200 m sunlit507

200–1000 m twilight0

1–4 km midnight1

>4 km abyssal0

median 3 m · max 2 864.9 m · 508 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 237≤1 km 6≤10 km 47>10 km 1

291 georeferenced · 380 without coordinates

Open the mapobservation + sensor671

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 213≤1 km 11≤10 km 5

229 georeferenced · 508 without coordinates

Open the institutions mapphysical evidence737

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	79
730location not on record	37
RWSlocation not on record	32
RPlocation not on record	30
Helsinki, FI	19
Washington, US	10
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	9
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	7
630location not on record	5
IfAÖ- Institut für Angewandte Ökosystemforschung GmbHlocation not on record	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	3
Sykelocation not on record	3
VUB/Ugentlocation not on record	2
Stockholm, SE	2
Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record	2
Chicago, US	2
Champaign, US	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
SYKE- Okko Outinenlocation not on record	1
Universidad Simón Bolívarlocation not on record	1
Ieva Bardalocation not on record	1
CEFASlocation not on record	1
UGentlocation not on record	1

23 institutions · 253 of 737 vouchered records shown · 226 without an institution code

09Environmental DNA23 detections

Where the DNA of Apocorophium lacustre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys3

Countries4

Verifiable raw sequence linked14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map4 countries0

EstuaryAtlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–18.9

Seasonal swing summer↔winter16.8 °C

Max temp (day)15.9 °C 15.9–23.0

Min temp (night)11.1 °C 11.1–14.1

Precipitation65.3 mm/mo 65.3–95.4

Air humidity64.2 % 57.2–64.2

Moisture balance-1.60 mm/mo -36.9–7.50

Vapour deficit544 Pa 544–913

Wind speed4.20 m/s 2.90–4.30

Cloud cover47.0 % 31.9–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apocorophium lacustre

At a glance

Sources9 archives

Diet & foraging1

Habitat & environment2

Other traits2

At a glance

Record type2 224 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 224 records