Apocheima cinerarius

(Erschoff, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Apocheima

At a glance

Occurrence records27

Data sources7

Biological traits0

DNA specimens253

eDNA detections244

Sources7 archives

Databases and archives Apocheima cinerarius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI244 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics253 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 2 countries244 detections

DNA & barcodingBOLD253 specimens

01Narrative

Apocheima cinerarius is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Erschoff.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding253 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocheima cinerarius has left across the world's sequence archives.

At a glance

DNA specimens253

BINs2

Marker genes12

eDNA detections244

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P591 bp consensus233 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

132Cvariable

150Amostly conserved

159Gvariable

177Gvariable

226Tvariable

247Tvariable

303Avariable

307Cvariable

315Cvariable

333Gmostly conserved

339Avariable

372Avariable

474Avariable

507Amostly conserved

516Avariable

GGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGTTCTCTAATTGGAGATGATCAAATTTATAACACTATTGTAACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes35

BINs2

Most divergent pair3.0%

OtherEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phigalia denticulatasame family6.3%Parapheromia falsatasame family6.9%Phigalia titeasame family6.9%Darisa fraterculasame family7.3%Microbiston lanariasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_024824 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type27 records

Wild obs. + sensor19

Museum / vouchered8

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 5≤1 km 6≤10 km 2>10 km 1

14 georeferenced · 5 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	8

1 institutions · 8 of 8 vouchered records shown

09Environmental DNA244 detections

Where the DNA of Apocheima cinerarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found244

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 244 detections have coordinates

Open the map2 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.00 °C 1.60–6.20

Seasonal swing summer↔winter31.2 °C

Max temp (day)10.5 °C 5.30–12.2

Min temp (night)-2.80 °C -4.00–-1.20

Precipitation10.3 mm/mo 4.90–45.7

Air humidity45.3 % 42.5–53.7

Moisture balance-55.9 mm/mo -79.6–-19.5

Vapour deficit507 Pa 333–527

Wind speed1.90 m/s 1.60–4.20

Cloud cover29.9 % 26.7–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)