Apocephalus borealis

Brues, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Phoridae/Apocephalus

At a glance

Occurrence records31

Data sources7

Biological traits0

DNA specimens40

eDNA detections32

Sources7 archives

Databases and archives Apocephalus borealis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA2 datasets · 2 countries32 detections

DNA & barcodingBOLD40 specimens

01Narrative

Apocephalus borealis is a species of North American parasitoid phorid fly that attacks bumblebees, honey bees, and paper wasps. This parasitoid's genus Apocephalus is best known for the "decapitating flies" that attack a variety of ant species, though A. borealis attacks and alters the behavior of bees and wasps. These flies are colloquially known as zombie flies and the bees they infect are colloquially known as zombees. Association with honey bees has so far only been documented from California, South Dakota, Oregon, Washington, British Columbia (Vancouver Island), and Vermont.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocephalus borealis has left across the world's sequence archives.

At a glance

DNA specimens40

BINs2

Marker genes2

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Amostly conserved

2Cmostly conserved

39Avariable

78Gvariable

105Tvariable

144Tvariable

147Gvariable

174Avariable

216Amostly conserved

267Gmostly conserved

342Tvariable

360Cvariable

372Gvariable

411Gvariable

447Cvariable

468Tvariable

477Gvariable

483Tmostly conserved

507Cvariable

577Cmostly conserved

621Tvariable

630Avariable

648Gvariable

ACTTTATATTTTATTTTTGGAGCATGAGCAGGAATAGTAGGTACTTCTTTAAGAATTATAATTCGGGCAGAACTAGGGCATCCTGGTGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes8

BINs2

Most divergent pair3.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megaselia subpleuralissame family11.4%Megaselia giraudiisame family12.0%Megaselia flammulasame family12.2%Megaselia luteasame family12.5%Gymnophora taleasame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor3

Museum / vouchered28

Origin

Native12

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 8≤10 km 1

9 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	12
DOI/FWS, Kenai National Wildlife Refugelocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Cambridge, US	1

4 institutions · 23 of 28 vouchered records shown · 4 without an institution code

09Environmental DNA32 detections

Where the DNA of Apocephalus borealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1 Boreal Forest1. Forest & Woodland | 1.1 Forest - BorealMixed habitatForest17. Other

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 3.30–17.4

Seasonal swing summer↔winter20.7 °C

Max temp (day)17.7 °C 5.50–21.4

Min temp (night)9.10 °C 0.3–14.7

Precipitation63.7 mm/mo 16.4–90.4

Air humidity59.8 % 54.4–65.1

Moisture balance-30.1 mm/mo -86.1–42.5

Vapour deficit633 Pa 323–860

Wind speed2.60 m/s 1.50–4.60

Cloud cover42.5 % 23.8–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)