Apocatops nigrita

(Erichson, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Leiodidae/Apocatops

At a glance

Occurrence records2 244

Data sources4

Biological traits0

DNA specimens17

eDNA detections37

Sources4 archives

Databases and archives Apocatops nigrita's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 244 records

Environmental DNA3 datasets · 5 countries37 detections

DNA & barcodingBOLD17 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apocatops nigrita has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes5

eDNA detections37

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 60 variable positions, in barcode order

1Cmostly conserved

2Amostly conserved

3Cmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

13Tmostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

20Gmostly conserved

26Tmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

34Gmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

58Amostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

290Tmostly conserved

369Gmostly conserved

389Gmostly conserved

572Amostly conserved

CACTTTATATTTTATTTTCGGAGCTTGAGCTGGGATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Catops neglectussame family10.5%Catops tristissame family11.1%Fissocatops westisame family11.9%Catops fuliginosussame family12.0%Catops coracinussame family12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28SCHOLC

animal barcoderibosomalmarker

08Occurrence & distribution

Record type2 244 records

Wild obs. + sensor1 242

Museum / vouchered907

Cultivated / captive35

Fossil6

Other54

Range

Area of Occupancy AOO3 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 770≤1 km 151≤10 km 234>10 km 1

1 156 georeferenced · 86 without coordinates

Open the mapobservation + sensor1 242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 190≤1 km 420≤10 km 116>10 km 29

755 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence907

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 35 records without

Open the mapnot free-living35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kuopio, FI	288
SLU Artdatabankenlocation not on record	194
Bonn, DE	95
Helsinki, FI	62
NMOKlocation not on record	41
Metsähallituslocation not on record	38
Salzburg, AT	32
Muzeum Górnośląskie w Bytomiulocation not on record	28
Copenhagen, DK	9
Uniwersytet Wrocławskilocation not on record	8
TMPMlocation not on record	6
ZSMlocation not on record	4
CBDClocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
NCMGlocation not on record	4
MZLUlocation not on record	4
Stockholm, SE	3
ZMAAlocation not on record	3
Oulu, FI	2
Tilburg, NL	2
Naturalis Biodiversity Centerlocation not on record	1

21 institutions · 832 of 907 vouchered records shown · 75 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA37 detections

Where the DNA of Apocatops nigrita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys3

Countries5

Verifiable raw sequence linked22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map5 countries0

kotkanpesa, saalisjatteetFen edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 4.50–14.0

Seasonal swing summer↔winter20.6 °C

Max temp (day)14.6 °C 8.90–17.7

Min temp (night)6.10 °C 0–9.30

Precipitation59.7 mm/mo 45.5–115

Air humidity58.7 % 55.7–62.2

Moisture balance-17.0 mm/mo -41.8–38.9

Vapour deficit515 Pa 352–667

Wind speed2.90 m/s 2.20–4.30

Cloud cover48.7 % 38.9–58.8

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apocatops nigrita

At a glance

Sources4 archives

At a glance

Record type2 244 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 244 records