Aplysiopsis enteromorphae

(Eliot, 1905) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Hermaeidae/Aplysiopsis

At a glance

Occurrence records800

Data sources9

Biological traits4

DNA specimens10

eDNA detections11

Sources9 archives

Databases and archives Aplysiopsis enteromorphae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility776 records↗

OBISOcean Biodiversity Information System24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS800 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aplysiopsis enteromorphae is a species of sacoglossan sea slug, a shell-less marine opisthobranch gastropod mollusk in the family Hermaeidae.Jensen K. R. (November 2007). "Biogeography of the Sacoglossa (Mollusca, Opisthobranchia)" . Bonner zoologische Beiträge 55(2006)(3-4): 255–281.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysiopsis enteromorphae has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.79%

Haplotypes1

BIN1

Where individuals differ — all 20 variable positions, in barcode order

82Cmostly conserved

139Cmostly conserved

169Cmostly conserved

187Tmostly conserved

235Cmostly conserved

263Cmostly conserved

271Tmostly conserved

290Cmostly conserved

295Cmostly conserved

301Tmostly conserved

313Tmostly conserved

340Cmostly conserved

421Tmostly conserved

505Tmostly conserved

539Tmostly conserved

562Tmostly conserved

565Tmostly conserved

613Tmostly conserved

614Gmostly conserved

615Amostly conserved

AACCCTATACATGGTTTTTGGAATGTGGTGCGGCCTTGTAGGAACAGGTCTAAGTCTTTTAATTCGTTTTGAGCTTGGTACCTCTGGAGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Elysia diomedeasame order16.2%Hermaea oliviaesame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type800 records

Wild obs. + sensor753

Museum / vouchered47

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 351≤1 km 179≤10 km 11>10 km 151

692 georeferenced · 61 without coordinates

Open the mapobservation + sensor753

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤1 km 12≤10 km 27

39 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	19
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Washington, US	1

6 institutions · 24 of 47 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Aplysiopsis enteromorphae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

sand, Ulva, and various other algae, under r…floating docks

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.1–17.3

Seasonal swing summer↔winter8.40 °C

Max temp (day)18.3 °C 16.7–21.6

Min temp (night)11.1 °C 8.60–13.9

Precipitation57.5 mm/mo 5.40–75.5

Air humidity62.8 % 57.1–63.0

Moisture balance-30.6 mm/mo

Vapour deficit695 Pa 560–739

Wind speed1.40 m/s

Cloud cover34.4 % 26.0–37.3

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)