Aplysia punctata

(Cuvier, 1803) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Aplysiida/Aplysiidae/Aplysia

At a glance

Occurrence records8 626

Data sources12

Biological traits8

DNA specimens65

eDNA detections84

Sources12 archives

Databases and archives Aplysia punctata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 994 records↗

OBISOcean Biodiversity Information System2 632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics65 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Chemical compositionLOTUS · NPASS75 compounds

Occurrence & distributionGBIF · OBIS8 626 records

Environmental DNA1 datasets · 5 countries84 detections

DNA & barcodingBOLD65 specimens

Genome at a glanceGoaT2n = 24

01Narrative

In the Canary Islands Aplysia punctata is a species of sea slug in the family Aplysiidae, the sea hares.Gofas, S. (2011). Aplysia punctata. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138758 on 2012-03-31 It reaches a length of up to 20 cm and is found in the northeast Atlantic, ranging from Greenland and Norway to the Mediterranean Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length20 cm

Body mass130 g

Life cycle & reproduction1

Max. longevity12 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max83 m

Depth min0 m

03Chemical composition75 compounds

Compounds documented for Aplysia punctata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols11

N-acyl amines8

Carotenoids (C40, β-β)5

Laurane sesquiterpenoids4

Quinoline alkaloids4

Documented compounds75 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Linalyl acetate	present	NPASS
(1aR,1bR,3S,3aS,5R,7bS,9R,9aS)-5-[(1S)-1-bromo-2-hydroxyethyl]-1a-(hydroxymethyl)-5,7b-dimethyl-1,1b,2,3,3a,4,6,8,9,9a-decahydrocyclopropa[a]phenanthrene-3,9-diol	present	LOTUS
(1R,2S,6R)-2-[(3S)-3-hydroxy-3-methylpent-4-enyl]-1,3,6-trimethylcyclohex-3-en-1-ol	present	LOTUS
(1R,2S,6S)-2-[(3S)-3-hydroxy-3-methylpent-4-enyl]-1,3,6-trimethylcyclohex-3-en-1-ol	present	LOTUS
(1S,2R,4R)-4-bromo-2-[2-[(2S,3R,6S)-3-bromo-6-ethenyl-2,6-dimethyloxan-2-yl]ethyl]-1,3,3-trimethylcyclohexan-1-ol	present	LOTUS
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(1S,5R,7S,8S,10R,16R)-5-[(1S)-1-bromo-2-hydroxyethyl]-8,16-dihydroxy-1,5-dimethyltricyclo[8.6.0.02,7]hexadec-2-ene-11,15-dione	present	LOTUS
(2aR,3S,4aR,5S,7S,8R,8aS)-3-bromo-2a,4a,5,8-tetramethyl-1,2,3,4,5,6,7,8-octahydrocyclobuta[i]inden-7-ol	present	LOTUS
(2e,6e,8e)-N-(2-hydroxy-2-methylpropyl)-10-oxo-2,6,8-decatrienamide	present	NPASS
(2E,6R,7E,9E)-6-hydroxy-N-(2-hydroxy-2-methylpropyl)-11-oxododeca-2,7,9-trienamide	present	NPASS

05DNA & barcoding65 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia punctata has left across the world's sequence archives.

At a glance

DNA specimens65

BINs4

Marker genes3

eDNA detections84

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

5Cmostly conserved

37Gmostly conserved

55Amostly conserved

56Tmostly conserved

70Cmostly conserved

73Amostly conserved

79Amostly conserved

91Cmostly conserved

94Tmostly conserved

115Cmostly conserved

187Cmostly conserved

196Amostly conserved

202Amostly conserved

206Cmostly conserved

223Cmostly conserved

301Cvariable

382Tmostly conserved

401Cmostly conserved

421Gvariable

481Cmostly conserved

580Cmostly conserved

619Gmostly conserved

628Gmostly conserved

640Cmostly conserved

652Tmostly conserved

653Cmostly conserved

655Tmostly conserved

AACACTATACATAATCTTTGGAATGTGATGTGGGTTGGTAGGAACAGGTTTAAGATTATTAATTCGATTCGAACTTGGAACTGCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes12

BINs4

Most divergent pair15.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysia parvulasame genus3.7%Aplysia japonicasame genus13.0%Aplysia ghanimiisame genus13.8%Aplysia californicasame genus13.9%Aplysia kurodaisame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Aplysia punctata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type8 626 records

Wild obs. + sensor5 580

Museum / vouchered2 691

Other355

Origin

Native113

Range

Area of Occupancy AOO9 620 km²

Depth

0–200 m sunlit1 767

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 11.8 m · max 89.5 m · 1 767 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 4 075≤1 km 518≤10 km 113>10 km 21

4 727 georeferenced · 853 without coordinates

Open the mapobservation + sensor5 580

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 185≤1 km 88≤10 km 37>10 km 11

321 georeferenced · 2 370 without coordinates

Open the institutions mapphysical evidence2 691

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bergen, NO	76
DASSHlocation not on record	57
Institut Francais pour l'Etude de la Merlocation not on record	48
486location not on record	37
NTNU-VMlocation not on record	34
Bergen, NO	32
PNHSlocation not on record	32
Gothenburg, SE	26
SLU Artdatabankenlocation not on record	12
Cambridge, US	11
AUTHlocation not on record	7
CASlocation not on record	7
Natural History Museum Rotterdamlocation not on record	5
Citadel Hill, GB	4
CEFASlocation not on record	3
Museo Nacional de Ciencias Naturales (CSIC)location not on record	3
BioFokuslocation not on record	3
Barcelona, ES	3
Paris, FR	2
Goteborg Natural History Museumlocation not on record	2
South Kensington, GB	2
Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record	2
Brussels, BE	2
neflocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Washington, US	1
Chicago, US	1
University Museum of Bergen, Natural History Collectionslocation not on record	1
IEO-COMA-CSIClocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Museo Nacional de Ciencias Naturaleslocation not on record	1
Stockholm, SE	1
Natural History Museum, Londonlocation not on record	1

34 institutions · 421 of 2 691 vouchered records shown · 52 without an institution code

09Environmental DNA84 detections

Where the DNA of Aplysia punctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found84

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 84 detections have coordinates

Open the map5 countries0

AlgaeRock with algaeKelp leavesHard substrate (rocks with algae)On kelpSubmerged (on Sargassum muticum)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 3.60–16.3

Seasonal swing summer↔winter12.9 °C

Max temp (day)12.9 °C 4.70–18.3

Min temp (night)7.70 °C 2.10–14.5

Precipitation93.0 mm/mo 42.3–191

Air humidity63.3 % 54.3–65.1

Moisture balance23.2 mm/mo

Vapour deficit500 Pa 282–725

Wind speed5.10 m/s

Cloud cover51.8 % 34.3–65.1

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysia punctata

At a glance

Sources12 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits2

Compound class profile5 classes

Documented compounds75 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 626 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 626 records