Aplysia juliana

Quoy & Gaimard, 1832 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Aplysiida/Aplysiidae/Aplysia

At a glance

Occurrence records1 586

Data sources10

Biological traits8

DNA specimens23

eDNA detections11

Sources10 archives

Databases and archives Aplysia juliana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 209 records↗

OBISOcean Biodiversity Information System377 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF · OBIS1 586 records

Environmental DNA1 datasets · 0 countries11 detections

DNA & barcodingBOLD23 specimens

01Narrative

Aplysia juliana, the walking sea hare, is a species of sea hare, a marine gastropod in the family Aplysiidae.Gofas, S. (2010). Aplysia juliana Quoy & Gaimard, 1832. In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138756 on 2011-02-26

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length30 cm

Body mass468 g

Life cycle & reproduction1

Max. longevity12 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max60 m

Depth min0 m

Vulnerability10

03Chemical composition11 compounds

Compounds documented for Aplysia juliana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dihydroflavonols4

Cholestane steroids4

Monocyclic monoterpenoids1

Flavonols1

Flavones1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,5R,6R,10R,13S,15S)-6,10-dimethyl-5-[(2R)-6-methylheptan-2-yl]-16,17-dioxapentacyclo[13.2.2.01,9.02,6.010,15]nonadeca-8,18-dien-13-ol	present	LOTUS
(2R,3R)-2,3-Dihydro-3,5-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-methoxy-4H-1-benzopyran-4-one	present	NPASS
(2R,3R)-3,4'-Dihydroxy-5,7-dimethoxyflavone	present	NPASS
(3S,5R,6R,9S,10R,13R,14R,17R)-6-methoxy-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-1,2,3,4,6,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthrene-3,5-diol	present	LOTUS
(S)-alpha-Phellandrene	present	NPASS
5alpha,8alpha-Epidioxycholest-6-en-3beta-ol	present	LOTUS
Aromadendrin 7-methyl ether	present	NPASS
Blumeatin B	present	NPASS
Cholest-7-en-3beta,5alpha,6beta-triol	present	LOTUS
Genkwanin	present	NPASS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia juliana has left across the world's sequence archives.

At a glance

DNA specimens23

BINs3

Marker genes4

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Diversity (π)9.7%

Haplotypes1

BINs2

Where individuals differ — all 140 variable positions, in barcode order

6Gmostly conserved

9Cmostly conserved

12Gmostly conserved

24Amostly conserved

39Gmostly conserved

42Amostly conserved

84Tmostly conserved

93Tmostly conserved

99Amostly conserved

108Tmostly conserved

111Tmostly conserved

114Cmostly conserved

120Gmostly conserved

132Cmostly conserved

135Tmostly conserved

147Gmostly conserved

159Gmostly conserved

171Avariable

174Gmostly conserved

183Gmostly conserved

186Tmostly conserved

207Amostly conserved

208Tmostly conserved

219Cmostly conserved

222Tmostly conserved

228Gmostly conserved

234Tmostly conserved

249Tmostly conserved

258Tmostly conserved

270Cvariable

276Cvariable

280Tmostly conserved

282Gmostly conserved

289Cmostly conserved

300Amostly conserved

301Tmostly conserved

302Tvariable

312Tmostly conserved

315Amostly conserved

318Cmostly conserved

321Gmostly conserved

327Gmostly conserved

333Gmostly conserved

336Gmostly conserved

339Tmostly conserved

351Amostly conserved

357Tmostly conserved

363Cmostly conserved

369Amostly conserved

372Tmostly conserved

374Gmostly conserved

381Tmostly conserved

384Cmostly conserved

387Gmostly conserved

396Cmostly conserved

399Tmostly conserved

400Cmostly conserved

402Tmostly conserved

411Gmostly conserved

417Gmostly conserved

423Amostly conserved

426Tmostly conserved

429Amostly conserved

441Tmostly conserved

450Cmostly conserved

453Amostly conserved

462Cmostly conserved

468Tmostly conserved

471Amostly conserved

483Cmostly conserved

486Cmostly conserved

492Gmostly conserved

495Tmostly conserved

497Gmostly conserved

499Tvariable

504Tmostly conserved

507Gmostly conserved

510Gmostly conserved

511Tmostly conserved

515Tmostly conserved

516Gmostly conserved

517Tmostly conserved

524Cmostly conserved

525Amostly conserved

526Gmostly conserved

527Cmostly conserved

528Tmostly conserved

537Gmostly conserved

538Cvariable

539Tmostly conserved

540Amostly conserved

546Cvariable

549Gvariable

552Amostly conserved

555Tmostly conserved

556Tmostly conserved

561Cmostly conserved

575Tmostly conserved

579Tmostly conserved

591Tmostly conserved

597Tmostly conserved

600Cvariable

601Amostly conserved

602Cmostly conserved

603Tvariable

606Tvariable

607Tmostly conserved

609Cvariable

611Tmostly conserved

612Cmostly conserved

613Gvariable

614Amostly conserved

615Cmostly conserved

616Cmostly conserved

618Tmostly conserved

619Gmostly conserved

620Cmostly conserved

621Cvariable

622Gmostly conserved

624Gmostly conserved

+20 more variable positions not shown

ACATTGTACATGATTTTTGGAATATGATGTGGTCTAGTGGGAACAGGTTTAAGTCTTTTAATTCGATTTGAGCTTGGTACTGCTGGAGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysia oculiferasame genus10.9%Aplysia californicasame genus12.1%Aplysia parvulasame genus13.0%Aplysia kurodaisame genus13.0%Aplysia japonicasame genus13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5PH3

animal barcoderibosomalmarker

08Occurrence & distribution

Record type1 586 records

Wild obs. + sensor1 287

Museum / vouchered296

Other3

Range

Area of Occupancy AOO1 912 km²

Depth

0–200 m sunlit70

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 85 m · 70 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 681≤1 km 211≤10 km 103>10 km 25

1 020 georeferenced · 267 without coordinates

Open the mapobservation + sensor1 287

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 11≤1 km 96≤10 km 21>10 km 6

134 georeferenced · 162 without coordinates

Open the institutions mapphysical evidence296

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	30
Museums Victorialocation not on record	28
National Marine Biodiversity Institute of Korealocation not on record	26
CASlocation not on record	23
Los Angeles, US	6
Auckland, NZ	5
Sam Noble Oklahoma Museum of Natural Historylocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Alabama Museum of Natural Historylocation not on record	3
Wellington, NZ	3
ELMClocation not on record	3
Mexico City, MX	2
Philadelphia, US	2
Toyama, JP	1
Cambridge, US	1
Natick, US	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Washington, US	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1

21 institutions · 146 of 296 vouchered records shown · 15 without an institution code

09Environmental DNA11 detections

Where the DNA of Aplysia juliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysia juliana

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment2

Other traits3

Compound class profile5 classes

Documented compounds11 total

At a glance

Record type1 586 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 586 records