Aplonis metallica

(Temminck, 1824) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Sturnidae/Aplonis

At a glance

Occurrence records51 291

Data sources8

Biological traits27

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Aplonis metallica's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 291 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF51 291 records

DNA & barcodingBOLD4 specimens

01Narrative

The metallic starling (Aplonis metallica), also known as the shining starling, is a bird in the starling family native to the Moluccas, New Guinea, Queensland and the Solomon Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth7.2 mm

Beak length (culmen)23.1 mm

Beak length (nares)13.5 mm

Beak width6 mm

Body mass56.62 g

Body mass (female)55.7 g

Body mass (male)56.77 g

Hand-wing index34.2

Kipp's distance36.6 mm

Secondary length70.4 mm

Tail length97.4 mm

Tarsus length22.5 mm

Wing length108 mm

Life cycle & reproduction2

Egg mass5.9 g

Litter size1.7

Diet & foraging8

Fruit60 %

Ground33 %

Invertebrate20 %

Midhigh33 %

Nectar20 %

Trophic levelherbivore

Trophic nicheFrugivore

Understory33 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size767 162 km²

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplonis metallica has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

199Cvariable

CCTATATCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCACTAAGTCTCCTCATTCGAGCAGAACTAGGCCAACCTGGCGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplonis panayensissame genus6.5%Gracula religiosasame family7.1%Acridotheres fuscussame family9.4%Pastor roseussame family9.8%Lamprotornis ornatussame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 291 records

Wild obs. + sensor50 486

Museum / vouchered464

Other341

Origin

Native35

Range

Area of Occupancy AOO12 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 2 188≤1 km 2 235≤10 km 1 382>10 km 300

6 105 georeferenced · 44 381 without coordinates

Open the mapobservation + sensor50 486

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 6≤1 km 61≤10 km 215>10 km 3

285 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence464

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Wildlife Collectionlocation not on record	144
Sydney, AU	113
Seattle, US	31
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	26
Wuzhou, CN	23
Western Australian Museumlocation not on record	17
München, DE	17
Honolulu, US	17
CASlocation not on record	14
Ann Arbor, US	12
Copenhagen, DK	9
	9
Washington, US	6
Philadelphia, US	5
Auckland, NZ	3
Museums Victorialocation not on record	3
Brussels, BE	2
RBINS-Scientific Heritagelocation not on record	2
Cambridge, US	2
Denver, US	2
Toronto, CA	1
National Museum of Natural Sciencelocation not on record	1
Iowa City, US	1
Tasmanian Museum & Art Gallerylocation not on record	1

24 institutions · 461 of 464 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplonis metallica

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging8

Habitat & environment4

At a glance

Record type51 291 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 24 geolocated

Record type51 291 records